ID: 1153730888

View in Genome Browser
Species Human (GRCh38)
Location 18:8010648-8010670
Sequence CCTCCATCTCACCAAGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 393}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153730888_1153730893 2 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730893 18:8010673-8010695 GAGACAGCCTTGCACATGGGAGG 0: 1
1: 0
2: 3
3: 25
4: 405
1153730888_1153730894 8 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730894 18:8010679-8010701 GCCTTGCACATGGGAGGCTGAGG 0: 1
1: 0
2: 11
3: 227
4: 5444
1153730888_1153730900 22 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730900 18:8010693-8010715 AGGCTGAGGTCAGGGAGGGTAGG 0: 1
1: 0
2: 7
3: 79
4: 789
1153730888_1153730898 17 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730898 18:8010688-8010710 ATGGGAGGCTGAGGTCAGGGAGG 0: 1
1: 0
2: 13
3: 180
4: 981
1153730888_1153730892 -1 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730892 18:8010670-8010692 GGAGAGACAGCCTTGCACATGGG 0: 1
1: 0
2: 2
3: 17
4: 220
1153730888_1153730891 -2 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730891 18:8010669-8010691 GGGAGAGACAGCCTTGCACATGG 0: 1
1: 0
2: 0
3: 26
4: 290
1153730888_1153730897 14 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730897 18:8010685-8010707 CACATGGGAGGCTGAGGTCAGGG 0: 1
1: 0
2: 26
3: 174
4: 1651
1153730888_1153730896 13 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730896 18:8010684-8010706 GCACATGGGAGGCTGAGGTCAGG 0: 1
1: 1
2: 9
3: 134
4: 1297
1153730888_1153730899 18 Left 1153730888 18:8010648-8010670 CCATGGACTTGGTGAGATGGAGG 0: 1
1: 1
2: 0
3: 36
4: 393
Right 1153730899 18:8010689-8010711 TGGGAGGCTGAGGTCAGGGAGGG 0: 1
1: 2
2: 21
3: 208
4: 1446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153730888 Original CRISPR CCTCCATCTCACCAAGTCCA TGG (reversed) Intronic
901032851 1:6318304-6318326 CCTCCATCTCCCAAAGTGCTGGG + Intronic
901082264 1:6590222-6590244 GCTCCACCTCCCCAGGTCCAAGG + Intergenic
901356159 1:8651161-8651183 CCTCCATCTCCCAAAGTCTTGGG - Intronic
901420105 1:9145056-9145078 CCTCCCTCTCACCAAACCCAGGG - Intergenic
901649964 1:10737723-10737745 CCTCCCACTCACCAAGGCCAGGG + Intronic
901859511 1:12064868-12064890 CCTTCATCTCCCCAAGACCTTGG - Intronic
902374995 1:16026430-16026452 CCTCCATCTCCCCAACCCCCAGG - Intronic
902590367 1:17469575-17469597 CCTCCATCTCCCAAAGTGCAGGG - Intergenic
902848858 1:19137046-19137068 CCTCCACCTCCCCAAGTGCTGGG - Intronic
903013162 1:20344316-20344338 CCTCCAAGTCCCCCAGTCCAAGG + Intronic
903302202 1:22387093-22387115 CCTCCACCCCACCCAGTCCCAGG - Intergenic
904155048 1:28475976-28475998 CCTCCATCTCCCAAAGTGCTGGG + Intronic
904170790 1:28591176-28591198 CCTCCATCTCCCAAAGTGCTGGG - Intronic
904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG + Intergenic
904769363 1:32872252-32872274 CTTCCATCTCACCCCTTCCAAGG - Intronic
904930552 1:34083663-34083685 CCTCCATCTCCCAAAGTGCTAGG - Intronic
904944754 1:34191054-34191076 CCTCCATGTGAACAAGCCCAGGG - Intronic
905119725 1:35672451-35672473 CCTCCCTTCCACAAAGTCCAGGG + Intergenic
905177287 1:36145277-36145299 CCTCCACCTCCCAAAGTGCAGGG + Intronic
905635836 1:39551474-39551496 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
905788343 1:40775783-40775805 CCTCCATCTCCCAAAGTGCTAGG - Intergenic
905793892 1:40804563-40804585 CCTCCATCTCCCAAAGTGCTGGG - Intronic
905813080 1:40927237-40927259 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
906350642 1:45055876-45055898 CCTCCATCTCCCAAAGTGCTGGG - Intronic
906915933 1:50010055-50010077 CCTCCACCTCCCAAAGTGCAGGG - Intronic
908705885 1:66954065-66954087 CCTCCATCTCTCCTAATCCCTGG + Intronic
910900867 1:92119534-92119556 CCTCAATCTCCCCAAGTGCTAGG + Intronic
911094004 1:94041163-94041185 GCTCCTTCTCACCCAGGCCAGGG + Intronic
911117810 1:94264737-94264759 CCTCCATCTCACCCCATCCCCGG + Intronic
914335828 1:146714383-146714405 CCACCACCCCACCCAGTCCATGG + Intergenic
914777732 1:150753697-150753719 CCTCCACCTCCCAAAGTCCTGGG - Intronic
914786740 1:150839988-150840010 CCTCCATCTCCCAAAGTGCTGGG - Intronic
914842717 1:151261701-151261723 CCTCCACCTCCCCAAGTGCTGGG - Intronic
915154532 1:153863872-153863894 CCTCGATCTCACAAAGTGCTGGG + Intronic
915435679 1:155903980-155904002 CCTCCACCTCCCCAGGTCAAGGG + Intronic
917315449 1:173720001-173720023 CCTCCATCTCCCAAAGTGCTGGG - Intronic
917482305 1:175422877-175422899 CAACCACCTCATCAAGTCCAAGG - Intronic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
917787549 1:178475033-178475055 CCTCCTTTTCACCAAGTCCCAGG + Intronic
918098189 1:181351371-181351393 CCTCCACCTCAGAGAGTCCAGGG - Intergenic
919934830 1:202244758-202244780 CCTCCATTTCACCCACTACAAGG + Intronic
921569074 1:216756959-216756981 CACCCATCTCCCCAAGACCAAGG + Intronic
922862670 1:228832658-228832680 CCTCCATCTCCCAAAGTTCTGGG - Intergenic
922895810 1:229099212-229099234 CTTCCACCTCACCAGGTCCCAGG + Intergenic
923510808 1:234650849-234650871 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
923575921 1:235158865-235158887 CCTCCGTCTCCCCAAGTGCTAGG - Intronic
923605052 1:235435651-235435673 CCTCCATCGCACCAAATGCAGGG + Intronic
924170747 1:241337602-241337624 GCTCCATCTCACTAAATGCACGG + Intronic
1063677665 10:8155734-8155756 CCTCCCTCTCCCCAAGTCCCTGG + Intergenic
1064434687 10:15301043-15301065 CCTCCAGCTCTCCATGTCCTTGG - Intronic
1064998667 10:21317935-21317957 CCTCCACCTCCCAAAGTCCTGGG + Intergenic
1065071465 10:22028870-22028892 CCCCCATCCCACCCAGCCCATGG - Intergenic
1065167818 10:22999295-22999317 CCTCCACCTCGCAAAGTGCAGGG - Intronic
1066449097 10:35511840-35511862 TCTCCATCTCTCCAGGTTCACGG - Intronic
1069973416 10:72192742-72192764 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1070276220 10:75010021-75010043 CCTACATGACACCAAGTCCATGG + Intronic
1071260131 10:83912288-83912310 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1072723517 10:97796394-97796416 CCATCATCTCCCAAAGTCCATGG + Intergenic
1073988141 10:109232731-109232753 CCTCCATCTCAGCAAGGCAGAGG - Intergenic
1074554348 10:114474628-114474650 CCTCCACCTCCCCAAGTGCTGGG + Intronic
1075557948 10:123446983-123447005 CCTCCTCCTCCCCAAGCCCAAGG - Intergenic
1076137903 10:128057415-128057437 CCTCCATCCCACCAAGGCCCTGG - Intronic
1077159933 11:1108050-1108072 CCTCCCTCTCACCCAGCCCAGGG - Intergenic
1077239284 11:1502285-1502307 CCTCCAGCCCACCCAGGCCAGGG + Intergenic
1079565565 11:21878149-21878171 CCTCCCTCTCTTCAAGCCCAAGG - Intergenic
1080997943 11:37627533-37627555 CCTCCATCTCCCTCAGTCCCTGG + Intergenic
1081116129 11:39203657-39203679 CCTCCACCTCCCAAAGTCCTGGG - Intergenic
1081616691 11:44595361-44595383 CCACCATCCCAGCAACTCCAAGG - Intronic
1081967682 11:47179341-47179363 CCTCCATCTCCCCGAGGCCCTGG - Intronic
1082007909 11:47430435-47430457 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1083182171 11:60994035-60994057 CCTCTCTGTCACCAAATCCAAGG - Intronic
1083614305 11:64018776-64018798 CCTGCATCTCCCCCAGTCCCCGG - Intronic
1083726358 11:64630566-64630588 CCTCCATGTCCCCAGGACCAGGG - Exonic
1084040328 11:66539112-66539134 CCCCCAACTCACCCAGGCCAGGG + Exonic
1084156670 11:67317052-67317074 CCTCCGTCTCCCAAAGTCCTGGG + Intergenic
1084383987 11:68830595-68830617 TCTCCAGCTCACCTATTCCATGG + Intronic
1086360271 11:86051408-86051430 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1092179230 12:6433946-6433968 CCTCCATCTCTCAAAGTGCTGGG + Intergenic
1092219184 12:6701014-6701036 CCTCCTTCACCCCAACTCCAGGG + Intergenic
1092358543 12:7816955-7816977 CCTCCACCTCCCAAAGTCCTAGG + Intronic
1092561806 12:9622543-9622565 CCTCCACCTCACAAAGTGCTGGG + Intergenic
1093094594 12:14958234-14958256 CCTCCATGTCACCAGGGACAGGG - Intronic
1093232184 12:16559698-16559720 CCTCCACCTCCCAAAGTGCAGGG - Intronic
1095447653 12:42298171-42298193 CCTCCATCTCCCAAAGTTCTGGG + Intronic
1095938589 12:47711070-47711092 CCTCCAGCTCCCCATGTGCAAGG + Intronic
1096279040 12:50235912-50235934 CCTCCATCTCCCGAAGTGCTGGG - Intronic
1098227808 12:68342791-68342813 ACTCCATCTCACAAAGTCTAGGG - Intergenic
1099510800 12:83534336-83534358 TCTCTATCTCACCCAATCCATGG - Intergenic
1099629856 12:85128789-85128811 ACTCAATCTCACCAAGACCAGGG + Intronic
1100389759 12:94138186-94138208 CCTTCTTCTGGCCAAGTCCATGG - Intergenic
1100911037 12:99363904-99363926 CCTCCATCTCACTAAGGTAAGGG - Intronic
1100911051 12:99363981-99364003 CCTCCCTCTCACCAAGGGGAGGG + Intronic
1101054046 12:100894274-100894296 CCTCCACCACACCAGGTCCTTGG - Intronic
1101154846 12:101917608-101917630 CCTCCAGCTCTCCAACTCCTGGG - Intronic
1101338441 12:103818624-103818646 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1101990815 12:109483329-109483351 CATGCAACTCACCAAGACCAGGG - Intronic
1102783614 12:115585900-115585922 TCTCTATCTCCCCAAGCCCAAGG - Intergenic
1103251803 12:119506350-119506372 CCTCCATCTCCCTAAGTTCTGGG - Intronic
1104300128 12:127557482-127557504 CCTCCACCTCCCAAAGTCCTGGG - Intergenic
1104559004 12:129826788-129826810 CCTGCATTTCACCCAGTCCTCGG - Intronic
1105211202 13:18258161-18258183 CATCCATCTCACCATGCCCGAGG + Intergenic
1105449389 13:20485410-20485432 CCTCCACCTCCCAAAGTCCTGGG - Intronic
1108080845 13:46733376-46733398 CCTCCTTCCCACCAAAGCCAGGG - Intronic
1109096044 13:58117863-58117885 GCTCCATCTTACCAAAACCAGGG - Intergenic
1110113045 13:71775032-71775054 CCTCCATCTCTCAAAGTGCTGGG - Intronic
1111961940 13:94821459-94821481 CCTCAATCTCACAAAGTGCTGGG - Intergenic
1113088336 13:106591771-106591793 CCTCCAGCTCACCAAGTCCAGGG + Intergenic
1113588702 13:111483261-111483283 CCTTCCTCTCACCAGCTCCAGGG - Intergenic
1114330453 14:21632158-21632180 CCTCCATCTCCCAAAGTACTGGG - Intergenic
1115079600 14:29434915-29434937 CCTCCATCTCCCAAAGTGCTAGG + Intergenic
1115121928 14:29947338-29947360 CCTCCACCTCACAAAGTGCTGGG + Intronic
1115816548 14:37170282-37170304 CCTCCGCCTCACAAAGTCCTGGG + Intronic
1117252145 14:53948709-53948731 CCTCTTTCTGCCCAAGTCCAGGG + Intergenic
1119037036 14:71239170-71239192 CCTCCCTCCCACCCAGTCCCTGG - Intergenic
1119836677 14:77756377-77756399 CCTCCATCTCCCAAAGTACTGGG + Intronic
1119874416 14:78045287-78045309 CCTCAATCTCCCAAAGTACAAGG - Intergenic
1120530161 14:85622192-85622214 CAGCCATCTCACCAAGCTCAAGG + Exonic
1122312283 14:100804753-100804775 CCTCAGTCCCACAAAGTCCAGGG - Intergenic
1122849041 14:104516802-104516824 CCTCCTTCCCACCTAATCCACGG + Intronic
1123986895 15:25654164-25654186 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1124181396 15:27478979-27479001 CACCCATCTCACCTAGTCCTAGG - Intronic
1124957045 15:34366706-34366728 CCTTCATCTCTCCAACCCCAGGG + Intronic
1125812512 15:42553555-42553577 CCTCCACCTCCCTAAGTGCAGGG + Intronic
1125904316 15:43376509-43376531 CATCCATCTCAACAGGGCCAAGG + Exonic
1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG + Intronic
1126592286 15:50352584-50352606 CCTCCACCTCCCCAAGTGCTGGG + Intronic
1126849713 15:52789617-52789639 CCTGCATCCCACCATGACCATGG - Exonic
1127241880 15:57124920-57124942 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1127350110 15:58142812-58142834 CATCCATCTCTCCAAGTCTAGGG + Intronic
1128666449 15:69541662-69541684 CCTCGATCTCTCCAAGTGCTGGG + Intergenic
1129063767 15:72883676-72883698 CCTCCATCTCCCCATCTCAAGGG + Intergenic
1129524321 15:76204322-76204344 CCCTCATCTCACCCAGCCCATGG - Exonic
1129549584 15:76433255-76433277 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1129713114 15:77831509-77831531 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1130352434 15:83104639-83104661 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1130950673 15:88584624-88584646 CCACGACCTCACCATGTCCAAGG - Intergenic
1131494257 15:92891352-92891374 CCTCCACCTCCCCAAGTGCTGGG + Intronic
1132038316 15:98504586-98504608 CCCCCACCACACCAAGCCCAAGG + Intronic
1133405597 16:5521887-5521909 CATCCATCTCAACATGTCCTGGG - Intergenic
1133575142 16:7081753-7081775 CATCCATGTTACCAAGGCCAGGG - Intronic
1134128073 16:11630067-11630089 GCTCCTTCTCATCAAGTGCAAGG + Intronic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1134634325 16:15780563-15780585 CCTCCATCTCCCCGGGTTCAAGG + Intronic
1134647473 16:15881655-15881677 CCCCCACCCCACCAAGTCCAGGG + Intronic
1135283671 16:21174445-21174467 CCTCCACCTCCCAAAGTGCAGGG + Intronic
1135416049 16:22268703-22268725 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1136161452 16:28422319-28422341 CCTCCACCTCCCCAGGTTCAAGG + Intergenic
1136487745 16:30584059-30584081 CCTCCACCTCCCCAGTTCCAGGG - Intronic
1137991761 16:53164321-53164343 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1138593539 16:58016730-58016752 CCTCCACGTTACCAAATCCAAGG - Intronic
1138645311 16:58420341-58420363 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1138747587 16:59381422-59381444 TCTCCATCTCATCCTGTCCATGG - Intergenic
1139244504 16:65428296-65428318 CCTCCATCTCCCAAAGTGCTAGG + Intergenic
1139248758 16:65474317-65474339 ACTCCAAGTCACCAAGTCCCAGG - Intergenic
1139401730 16:66687413-66687435 CCTTCAGCTCCCAAAGTCCAAGG - Intronic
1139997796 16:70996843-70996865 CCACCACCCCACCCAGTCCATGG - Intronic
1140071751 16:71656584-71656606 CTGCCATCTCAGCCAGTCCATGG + Exonic
1140448374 16:75050273-75050295 CCTCGACCTCACCAAGTGCCGGG - Intronic
1141203211 16:81913256-81913278 CCTCCATCTCCCCAGCCCCAGGG + Intronic
1143037632 17:4008817-4008839 CCACCATCTCACCATTGCCAGGG - Intronic
1143421302 17:6794840-6794862 CCTCGTTCTCACCAAGTCAATGG - Intronic
1143615916 17:8049020-8049042 CCTCCATCTCCCAAAGTGCTGGG - Exonic
1143873004 17:9971144-9971166 CCTCCACCTCACGAAGTACTGGG - Intronic
1144132961 17:12265830-12265852 CCTCCATTTCTTCAGGTCCATGG - Intergenic
1145758908 17:27414426-27414448 TCTCCATCTCCCCAAGTGCTGGG + Intergenic
1146017470 17:29245479-29245501 CCTCTAGCTCACCCAGGCCAGGG - Intergenic
1146146251 17:30419589-30419611 CCTCCACCTCACAAAGTGCTAGG + Intronic
1146169409 17:30621406-30621428 ACTCCTTCTCCCCAAGGCCAGGG - Intergenic
1146170153 17:30626043-30626065 ACTCCTTCTCCCCAAGGCCAGGG + Intergenic
1146177385 17:30674693-30674715 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1146343605 17:32042072-32042094 ACTCCTTCTCCCCAAGGCCAGGG + Intronic
1147861105 17:43524044-43524066 CCTCCATCACCCCAAGTCCTTGG + Exonic
1148342913 17:46884090-46884112 CCCACGTCTCAACAAGTCCAGGG + Intronic
1149787766 17:59450715-59450737 CCTCCATTTCTCCCAGTCCCTGG - Intergenic
1150782339 17:68133935-68133957 ACTCCTTCTCCCCAAGGCCAGGG - Intergenic
1150831546 17:68525204-68525226 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1151307121 17:73270189-73270211 CCTCCACCTCCCAAAGTCCTAGG - Intergenic
1151528205 17:74685962-74685984 CCTCCATCAACCCAAGTGCAGGG + Intronic
1151887293 17:76930690-76930712 CCTCCTACACACCAAGGCCAGGG - Intronic
1152819513 17:82429596-82429618 CCTCCAGGTCACTAAGTCCAGGG + Intronic
1153188291 18:2509923-2509945 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1153730888 18:8010648-8010670 CCTCCATCTCACCAAGTCCATGG - Intronic
1153873672 18:9345398-9345420 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1154141376 18:11827103-11827125 CCTCCTTCTTACCTTGTCCAAGG + Intronic
1154474814 18:14746131-14746153 CCTCAACCTCACCAAGTGCTAGG - Intronic
1155160423 18:23190823-23190845 CCTCCACCTCCCCAAGTGCTAGG - Intronic
1155530325 18:26760091-26760113 CCCCCTTCTCTCCAACTCCAAGG - Intergenic
1156304592 18:35865515-35865537 CCTCCATCTCCTCCAGTCCTAGG + Intergenic
1157005596 18:43580036-43580058 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1157212046 18:45751525-45751547 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1157549769 18:48573370-48573392 CCTCCATGTGACCCAGGCCAGGG + Intronic
1157750916 18:50177585-50177607 GCTCCCTCCCACCAACTCCAGGG - Intronic
1157841068 18:50959044-50959066 TCTCTTTCTCACCCAGTCCAGGG + Intergenic
1158364691 18:56720194-56720216 CCTCCATCTCCCAAAGTGCTAGG - Intronic
1158700563 18:59742110-59742132 CCTCAATCTCCCCAAGTGGAAGG - Intergenic
1158710349 18:59831765-59831787 CCTCCATCCCACCTAGGCCCAGG + Intergenic
1159851890 18:73534790-73534812 CCTCAGTGTCACCAAGTCCAGGG - Intergenic
1160828484 19:1091615-1091637 CCTCCCTCCCACCGCGTCCATGG - Intronic
1162254573 19:9478912-9478934 CCTCCACCTCCCAAAGTGCAGGG - Intronic
1162423266 19:10578315-10578337 CCTCCATCTCCCCAAGTGCTGGG - Intronic
1162426238 19:10598089-10598111 CCTCCCTCCCACCATCTCCAGGG + Intergenic
1162656051 19:12130617-12130639 TCTCCATCTCCCCAAGTTCTGGG - Intronic
1162658484 19:12150853-12150875 CCCCCATCTCACCCAGTTTATGG - Intronic
1162671423 19:12260702-12260724 ACTCCAGCTCCCCAATTCCAAGG + Intronic
1162872390 19:13596079-13596101 CCTCCATCTCACGGATTCAAGGG - Intronic
1164199691 19:23006839-23006861 CCTCCACCTCCCCAAGTGCTGGG + Intergenic
1165685791 19:37818519-37818541 CCTCCACCTCCCAAAGTCCTGGG - Intergenic
1165880049 19:39035990-39036012 CCTCCACCTCCCCAAGTGCTGGG + Intergenic
1166552680 19:43676860-43676882 CCTCCACCTCCCAAAGTCCTGGG + Intergenic
1168004872 19:53478525-53478547 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1168144427 19:54412504-54412526 CCTCCACCTCCCCAAGTGCTGGG + Intergenic
925217488 2:2110077-2110099 CCTCCATGGTGCCAAGTCCAGGG + Intronic
925829897 2:7883697-7883719 CCTCCATCACAGCAAATCAATGG + Intergenic
926200045 2:10788402-10788424 CCTCCACCTCCCAAAGTCCTGGG - Intronic
926741742 2:16116855-16116877 TGTCCTTCTCAGCAAGTCCAAGG + Intergenic
927023364 2:19040760-19040782 CCTCAATCTTAACAACTCCAAGG - Intergenic
927666276 2:25035147-25035169 CCTGCATCTCACCACAGCCAAGG - Intergenic
927719354 2:25372976-25372998 CCTCCTTCTCAGCAGGCCCAGGG + Intergenic
929917779 2:46150622-46150644 CTCCCATCTCACACAGTCCAGGG - Intronic
930564766 2:53005138-53005160 ACTCCATCTCAAAAAGGCCAGGG - Intergenic
932022200 2:68098751-68098773 CCACCCTCCCACCAAGGCCAAGG + Intronic
932859531 2:75275404-75275426 ACCCCTTCTCACCAACTCCAAGG + Intergenic
933975753 2:87508002-87508024 CCTCCATTTCAGCAAATCAAAGG - Intergenic
935377849 2:102418679-102418701 CATCCATTTCACAATGTCCATGG + Exonic
936147299 2:109988433-109988455 CCGCCTTCTCACCGACTCCAAGG + Intergenic
936197393 2:110383050-110383072 CCGCCTTCTCACCGACTCCAAGG - Intergenic
936318073 2:111442811-111442833 CCTCCATTTCAGCAAATCAAAGG + Intergenic
936450324 2:112628922-112628944 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
936516345 2:113183756-113183778 TCTCCATCTCACCAGCTCCAAGG + Intronic
936528564 2:113259053-113259075 CCTGAAGGTCACCAAGTCCAAGG + Intronic
937366664 2:121267166-121267188 CCTCCACCTCCCAAAGTCCTGGG + Intronic
939512366 2:143122974-143122996 TCTGCTTCTCACCAAGGCCAAGG + Intronic
942970091 2:181948277-181948299 CCTCCATCTCTCGAAGTCCCAGG + Intergenic
944191273 2:197006852-197006874 CCTCCACCTCACAAAGTGCTGGG - Intronic
945223352 2:207506771-207506793 CCTCCATGTAAGAAAGTCCAGGG + Intergenic
945455261 2:210045018-210045040 CCTCCATCTCCCAAAGTGCTGGG + Intronic
946130031 2:217599600-217599622 GCTCCTCCTCACCAGGTCCATGG + Intronic
946621429 2:221568009-221568031 CCTCCATCTTACTAGGTCAACGG - Intronic
947284832 2:228502315-228502337 CCATGATCTCACCAAGCCCATGG + Intergenic
947405332 2:229770217-229770239 CCTCCATCTCCCAAAGTGCTGGG + Intronic
948167441 2:235873977-235873999 CCTCCATCTCCCAAAGTGCTGGG + Intronic
948339422 2:237237612-237237634 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
948384547 2:237573432-237573454 CCTCCACCTCCCAAAGTGCAGGG - Intergenic
948932576 2:241141567-241141589 GCTCCATCTCACCCATTCCTCGG + Intronic
1168879523 20:1194662-1194684 CCACCATCTCACCAGGGTCAAGG + Intergenic
1170747868 20:19116755-19116777 CCTCCGTCTCCCAAAGTCCTGGG + Intergenic
1171333707 20:24363627-24363649 CCTCCATCTCCCAAAGTTCTGGG - Intergenic
1171753864 20:29081780-29081802 CCTCCTTCTCTCCTAGTCCTTGG + Intergenic
1171788381 20:29495750-29495772 CCTCCCTCTCTCCTAGTCCTTGG - Intergenic
1171965045 20:31523511-31523533 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1173144359 20:40511839-40511861 CTTACATCTCAACAAGTCAAAGG + Intergenic
1173622506 20:44447612-44447634 CTTCTGTTTCACCAAGTCCATGG + Intergenic
1173753944 20:45498374-45498396 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1175539433 20:59739067-59739089 CCACCCTCTCCCCAAGGCCACGG - Intronic
1175910416 20:62402680-62402702 GCCCCATCTCATCAAGTCCCAGG + Intronic
1175986338 20:62765823-62765845 CCTCCAGCACACCAAGACCCAGG + Intergenic
1176100821 20:63363728-63363750 CCTCGATTTTAACAAGTCCAGGG - Intronic
1176306548 21:5126561-5126583 GCTCCATCTCCCCAAGGGCAAGG + Intronic
1176718413 21:10373814-10373836 CCTCCAACTCCCAAAGTCCTGGG - Intergenic
1178316187 21:31568566-31568588 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1178985829 21:37302048-37302070 CCTCCATCTCCCCAGCTCAAGGG - Intergenic
1179268030 21:39822700-39822722 CCTCCATCTTGTCAAATCCAAGG + Intergenic
1179850511 21:44135469-44135491 GCTCCATCTCCCCAAGGGCAAGG - Intronic
1180696526 22:17754565-17754587 CCTCTATCTGACCAACTGCATGG - Intronic
1180765034 22:18341276-18341298 CATCCATCTCACCATGCCCGAGG - Intergenic
1180813995 22:18778408-18778430 CATCCATCTCACCATGCCCGAGG + Intergenic
1181200180 22:21212743-21212765 CATCCATCTCACCATGCCCGAGG + Intronic
1181541555 22:23575739-23575761 CCCCCATCTCTCCCAGGCCATGG + Intronic
1181701557 22:24624216-24624238 CATCCATCTCACCATGCCCGAGG - Intronic
1181779719 22:25183935-25183957 CCTCCATCTCACCTACACCCAGG - Intronic
1182233532 22:28857525-28857547 CCTCCATCTCCCAAAGTGCTAGG - Intergenic
1182580332 22:31305181-31305203 CCCCCATCACCCCCAGTCCATGG + Intergenic
1183233654 22:36599447-36599469 CCTCCACCTCCCAAAGTGCAGGG - Intronic
1183245249 22:36688292-36688314 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1183473079 22:38019762-38019784 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1183485470 22:38085797-38085819 CCTCCCTCTCCCCATGCCCAAGG + Intronic
1183515705 22:38264639-38264661 CCTCCATCTCCTCAACTCCCTGG - Intronic
1183654402 22:39176464-39176486 CCTCTATCACCCCAAGTCCAAGG - Intergenic
1184000565 22:41670237-41670259 CCTCCATGTCCTTAAGTCCATGG + Intergenic
1184210761 22:43034298-43034320 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1184558647 22:45248169-45248191 CCTCCATCTCCCAAAGTGCTAGG + Intergenic
1184581199 22:45418901-45418923 CCTCCATGTCGCCCAATCCAAGG + Intronic
1184662869 22:45973478-45973500 CCTTCATCCCCCCTAGTCCAGGG + Intronic
1203264094 22_KI270734v1_random:4095-4117 CATCCATCTCACCATGCCCGAGG + Intergenic
950397411 3:12744293-12744315 CTTCCATCCCACCAAGTGCAGGG + Intronic
950842765 3:15983421-15983443 CCTCCCTCCCAGCAAGTCCAGGG - Intergenic
951184749 3:19700503-19700525 TCTGCTTCTGACCAAGTCCATGG + Intergenic
951501714 3:23395088-23395110 CCTCCTTCTGACCAAGTCTCAGG - Intronic
952008967 3:28877244-28877266 TCTCCATCACACCTACTCCAAGG + Intergenic
953300914 3:41775059-41775081 CCTCCACCTCACAACGTCCCTGG - Intronic
953673100 3:44978992-44979014 CCTCCCTCTCACCAGTACCATGG + Intronic
954025953 3:47782957-47782979 CCTCCATCTCCCCAGCTCAAGGG - Intergenic
954395859 3:50292949-50292971 CCTACACCTCACTAAGCCCATGG - Exonic
954531738 3:51326873-51326895 CCTCCATCTCCCAAAGTGCTGGG + Intronic
954708789 3:52494941-52494963 CCTCCACCTTTCCAACTCCAGGG - Intergenic
954743600 3:52774136-52774158 CCTCTATGTCACCTAGCCCATGG - Intergenic
955964256 3:64371742-64371764 CCTCCATCTCCCAAAGTGCTGGG + Intronic
956231783 3:67025282-67025304 CCTCCATCTCCCAAAGTACTGGG + Intergenic
957860295 3:85940066-85940088 CCTCCATCTCCCAAAGTGCTGGG - Intronic
958443418 3:94184462-94184484 CCTCCATCTCAACATGGGCAAGG + Intergenic
958795652 3:98703856-98703878 CCTCCATCTCTCAAAGTGCTGGG + Intergenic
959539148 3:107521049-107521071 CCTCCATCTCACAAAGTGCTGGG + Intergenic
959686895 3:109157358-109157380 CCTCCATCTCATGAAGTGCTAGG + Intergenic
959697109 3:109260349-109260371 CCTCCATCTCCCAAAGTGCTAGG - Intergenic
961226627 3:125255495-125255517 CCTCCACCTCACAAAGTGCTGGG + Intronic
961411224 3:126721767-126721789 CCTGCATTTCCCCAAGCCCAAGG + Intronic
961495753 3:127289630-127289652 CCTCCATCTCCCAAAGTTCTGGG - Intergenic
961529060 3:127528766-127528788 CCTCCATGTCATCTAGGCCAGGG - Intergenic
963264802 3:143229279-143229301 CCTCCGTCTCACAAAGTGCTGGG - Intergenic
965550555 3:169960920-169960942 CTTCCATCTCAGCAAGTGGAAGG - Intergenic
969166761 4:5322753-5322775 TCTCCATCTCACCTTGCCCAGGG - Intronic
969602749 4:8186691-8186713 CCTCCATCTCCCAAAGTGCTGGG - Intronic
970599859 4:17633170-17633192 CCTCCATCTCCCAAAGTGCTGGG + Exonic
970848595 4:20574202-20574224 CCTCAATCTCCCCAAGTGCTGGG + Intronic
971229638 4:24790642-24790664 CTTCAATCTCACCAGTTCCAAGG - Intronic
971273309 4:25171829-25171851 CCGCCGTCTCTCCAAGTCAAAGG - Intronic
971314463 4:25555739-25555761 CCTCCATCTCCCAAAGTTCTGGG + Intergenic
971642967 4:29158852-29158874 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
972085969 4:35216127-35216149 CCTCAGTCTCCCCAAGTCCTGGG + Intergenic
972391038 4:38613891-38613913 TCTCCCTCCCACCATGTCCAAGG - Intergenic
972402980 4:38722448-38722470 CCTCCATCTCCCGAAGTTCTGGG + Intergenic
973059512 4:45703302-45703324 CCTCCACCTCCCAAAGTCCTGGG + Intergenic
973905270 4:55523043-55523065 CCTCCATCTCCCAAAGTGCTGGG - Intronic
975055642 4:69925840-69925862 CCTCCATCTCCCCAAGTGCTGGG + Intergenic
975079489 4:70258983-70259005 CCTCCCTCTCATCAAATCCATGG - Intergenic
976917913 4:90401777-90401799 CCTCCGTCTCCCAAAGTGCAGGG + Intronic
977888450 4:102279185-102279207 CATCAAACTCATCAAGTCCAAGG - Intronic
978451176 4:108835800-108835822 CCTCCATCTCCCAAAGTACTGGG + Intronic
979397613 4:120207318-120207340 CTTCCATTTCACTAAGTCCAAGG - Intergenic
979935242 4:126685777-126685799 ACTCCAGCTCACAAAGTCAAAGG + Intergenic
980501890 4:133666758-133666780 CCTCCATCTCACCGAGCTCAAGG + Intergenic
981072750 4:140561587-140561609 CCTCCATCTCCCAAAGTGCTGGG + Intronic
981108086 4:140904144-140904166 CCTCTAGCTCACCATCTCCATGG - Intronic
982435393 4:155379104-155379126 CCTCCATCTCCCCAAGTGCTGGG + Intergenic
982747913 4:159124103-159124125 CCTCCATCTCCCAAAGTGCTGGG + Intronic
983596445 4:169473006-169473028 CCTCCATCTCCCAAAGTGCTGGG - Intronic
987298652 5:16576863-16576885 CCTCCACCTCCCAAAGTCCTGGG + Intronic
987451057 5:18084561-18084583 ACTCCATGTCACCAAGTAAATGG - Intergenic
987961171 5:24810980-24811002 CCTCCATCTCCCAGAGTCCTGGG + Intergenic
988130597 5:27099077-27099099 CCTCCAACTCAACAATTTCAAGG + Intronic
988626066 5:32876162-32876184 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
988749065 5:34176630-34176652 CCTCCATCTCCCAAAGTGCTTGG - Intergenic
990850885 5:60203219-60203241 CCTCCACCTCCCAAAGTGCAGGG + Intronic
996084153 5:119286900-119286922 CATCCTTCTCTCCATGTCCAAGG + Intronic
996592201 5:125160601-125160623 CCTCCACCTCCCCAAGCCAAGGG + Intergenic
998261649 5:140636246-140636268 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
998329723 5:141314038-141314060 ACTCCATAACACCAAGGCCAGGG + Intergenic
998436854 5:142117489-142117511 CCTCCATCTCCCAAAGTGCTGGG + Intronic
998651189 5:144123494-144123516 CCTCAGTCTCCCAAAGTCCAGGG - Intergenic
998868911 5:146533233-146533255 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1000002570 5:157152922-157152944 CCTCCCTCTCACCAAACCCCTGG + Intronic
1001317881 5:170657244-170657266 CCTCGATCTCCCAAAGTCCTGGG + Intronic
1001763253 5:174224832-174224854 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1002295372 5:178227834-178227856 CCTCCACCTCTCCATCTCCATGG - Intronic
1004478237 6:15994303-15994325 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1004506097 6:16247977-16247999 CCTCCACCTCCCCAAATCCTGGG - Intronic
1006012489 6:31054426-31054448 ACTCCATCTCTCCAGGTCCCGGG - Intergenic
1006093431 6:31641649-31641671 CCTCGACCCCAACAAGTCCAGGG + Intronic
1006430110 6:33990318-33990340 CCTCCAAATCCCCAGGTCCAGGG + Intergenic
1006516800 6:34549923-34549945 CCTCCATCCATCCAAGTCCCTGG + Intronic
1006907478 6:37542706-37542728 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1007365226 6:41386831-41386853 CCTCCACATGGCCAAGTCCAAGG + Intergenic
1008427911 6:51380730-51380752 CCTCCACCTCACCAAGAAGAGGG + Intergenic
1008656731 6:53622366-53622388 CCTCCATCTCCCAAAGTGCTGGG - Intergenic
1011061442 6:83274348-83274370 GCTCCATCTCTTCAACTCCAGGG + Intronic
1013134510 6:107267841-107267863 CCTCCATCTCCCAAAGTACTGGG + Intronic
1015483986 6:133747120-133747142 CCTCCACCTCACAAAGTCCTGGG + Intergenic
1017248335 6:152252017-152252039 CCTCCACCTCCCAAAGTCCTGGG - Intronic
1017985883 6:159442853-159442875 CATGCATCTCAGCAAGGCCATGG + Intergenic
1018224201 6:161612137-161612159 CCTCCATCACATAAAGTGCAAGG + Intronic
1019376670 7:696522-696544 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1019671149 7:2279499-2279521 CCTCGGTCTCCCCAAGTCCCAGG - Intronic
1020063061 7:5167075-5167097 CCTCCACCTCCCAAAGTCCTGGG - Intergenic
1020975332 7:14999334-14999356 CCTCCATTTTGCCAAATCCAAGG + Intergenic
1022582324 7:31567873-31567895 CCTCCATCTCCCAAAGTCCTGGG - Intronic
1024038274 7:45527119-45527141 CCTTCATCTCTCCAAAACCAAGG + Intergenic
1024291850 7:47810800-47810822 ATTCCATCTCACCAAGACCCTGG + Intronic
1025010557 7:55394319-55394341 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1025060749 7:55804507-55804529 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1026867588 7:73833025-73833047 CCTCGACCTCCCCAAGTACAGGG - Intergenic
1027237244 7:76305303-76305325 CCACCCTCTCACCAGGCCCAGGG + Intergenic
1028816426 7:95151451-95151473 CCTCCCTCCCACCAAATCCCCGG - Intronic
1029034029 7:97499690-97499712 CCTCCATGTCGCCAACTCTATGG + Intergenic
1029127625 7:98305671-98305693 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1029203669 7:98855644-98855666 GCTCCCTCTCACCAAAGCCAGGG + Intronic
1029219211 7:98974562-98974584 GCTCCTGCTCCCCAAGTCCATGG - Intronic
1029333707 7:99881957-99881979 CCTCCATCTCCCAAAGTGCTGGG - Intronic
1029478429 7:100799087-100799109 CCTCCACCTCCCAAAGTACAAGG + Intergenic
1029551100 7:101237572-101237594 CCTGCATCCCACCATGTCGATGG - Exonic
1030109463 7:106014184-106014206 CCTCCACCTCCCCAAGTGCTGGG + Intronic
1033115247 7:138619323-138619345 CCTCAATCCCCCCAGGTCCAAGG - Intronic
1034276785 7:149827339-149827361 CCCCCATCTGATCAAGACCAAGG + Intergenic
1034594566 7:152177546-152177568 CCACCATCTCAACAAGAGCAAGG - Exonic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037502541 8:19499607-19499629 GCTCCATCTGCCCCAGTCCATGG + Intronic
1037606532 8:20442395-20442417 CTTCCATGTTACCAAATCCAGGG - Intergenic
1038130324 8:24723423-24723445 CCTCCACCTCCCAAAGTGCAGGG - Intergenic
1038380269 8:27086424-27086446 CCTCCACCTCACAAAGTGCTGGG - Intronic
1038637027 8:29295754-29295776 CCTCCATCTCCCAAAGTGCTAGG + Intergenic
1038769493 8:30463896-30463918 CCTCCACCTCCCCAAGTCCTGGG - Intronic
1039042724 8:33423518-33423540 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1039473226 8:37826539-37826561 CCTCCATGACCCCAAGTCCCTGG - Intronic
1039559909 8:38504580-38504602 CCTCCATCTCTCAAAGTGCTGGG + Intergenic
1039824875 8:41164405-41164427 CCTCCATCTCCCAAAGTTCTGGG + Intergenic
1039891136 8:41686315-41686337 CCTCCAGCTCACCAACAGCAGGG + Intronic
1039948498 8:42150264-42150286 CCTCCTCCTCACCACCTCCATGG + Intergenic
1042258812 8:66835017-66835039 CCTCGACCTCACCAAGTGCTGGG - Intronic
1043979587 8:86622663-86622685 CCTCCACCTCCCAAAGTCCTGGG + Intronic
1044279405 8:90338688-90338710 TCTCCCTCTGACCAAATCCAGGG + Intergenic
1045397016 8:101771269-101771291 CCTCCAGATCAGCAAGTTCAGGG + Intronic
1049405019 8:142448563-142448585 CCCCCATGTCATCAAGTCAAAGG + Intergenic
1052802868 9:32986445-32986467 CCTCCACCTCCCCAAGTGCTGGG + Intronic
1052820707 9:33136046-33136068 CCTCCATCTCTCCCAGACCTTGG - Intronic
1056886162 9:90446017-90446039 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1057258987 9:93573782-93573804 CCTCCACCTCACAAAGTGCTGGG - Intergenic
1059255035 9:112922154-112922176 CCTCCATCTCTCCACATCCAAGG - Intergenic
1061413001 9:130431181-130431203 CCTCCCTCTCAGCAAGCACAGGG + Intronic
1061516496 9:131093285-131093307 CCTCCAACTCACCAGCTCCTAGG - Intronic
1061674791 9:132209607-132209629 CCTCCATCTTCCCAGGTCCATGG - Intronic
1061863165 9:133478268-133478290 CCTGCATCTGACCAAATCCCAGG - Exonic
1061966480 9:134017082-134017104 CCTCCACCTCACAAAGTGCTGGG - Intergenic
1062006914 9:134243176-134243198 TCTCCCTCACAGCAAGTCCAGGG - Intergenic
1062211517 9:135366803-135366825 CCTCCATCTCGCTCAGGCCAAGG + Intergenic
1062229788 9:135475534-135475556 CCTCCATCTCCCAAAGTGCTGGG + Intergenic
1185837485 X:3358676-3358698 CCACCTTCCCACCAAGTCCATGG + Intergenic
1186341964 X:8655052-8655074 CCTCCTCCTCACCCAGTCCATGG - Intronic
1187866475 X:23727573-23727595 CCTCGATCTCCCAAAGTGCAAGG + Intronic
1190746064 X:53322055-53322077 CCCCCATCTCAGCCAGTCCCCGG + Intergenic
1191901287 X:66043051-66043073 CCTCCAACTCAGTAAGCCCAAGG - Intergenic
1192576996 X:72250988-72251010 CCTCCATCTCCCAAAGTGCTGGG + Intronic
1193154926 X:78161855-78161877 CCTCCATCTCCCAAAGTGCTGGG - Intergenic