ID: 1153732223

View in Genome Browser
Species Human (GRCh38)
Location 18:8025934-8025956
Sequence CAGGGAGAGCAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1609
Summary {0: 1, 1: 0, 2: 15, 3: 155, 4: 1438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153732219_1153732223 -5 Left 1153732219 18:8025916-8025938 CCTGTGTCAGAGATTTTCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 150
Right 1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG 0: 1
1: 0
2: 15
3: 155
4: 1438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153732223 Original CRISPR CAGGGAGAGCAGAAGGAGAA AGG Intronic
900536970 1:3183516-3183538 CAGGGACAGCAAAATGAGACGGG + Intronic
900631039 1:3635469-3635491 CAGTGAGAGCATGAGGAAAAAGG + Intronic
900648364 1:3719073-3719095 CAGGGGCGGCAAAAGGAGAAGGG - Intronic
900743756 1:4346171-4346193 CAGGGAGAGAGGAAGGAAAGAGG - Intergenic
900818442 1:4868339-4868361 AAGAGAGAGGAGGAGGAGAAGGG - Intergenic
900832813 1:4977328-4977350 CAGGGAGTGCTGAAGGTGCAAGG - Intergenic
900892348 1:5458547-5458569 GAAGGAGAAAAGAAGGAGAAAGG - Intergenic
901390971 1:8945894-8945916 CAGGGACAGCAGAAGCACCAGGG - Exonic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901642378 1:10699217-10699239 CCAGGAGAGGGGAAGGAGAACGG - Intronic
901672623 1:10865118-10865140 CAGGGAGGGGAGAAGGACCAGGG + Intergenic
901843016 1:11965511-11965533 TAGGGAGAGCAGATGGCCAAGGG - Exonic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902262511 1:15237399-15237421 GAGGGAGAGAAGGAAGAGAAAGG - Intergenic
902606342 1:17571409-17571431 CAGGGACAGGAGACGGAGCATGG + Intronic
902812484 1:18896435-18896457 CAAGGAGAGGAGAAATAGAAAGG + Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903161501 1:21492261-21492283 CAGGGATAGGAGATGGCGAAGGG - Intergenic
903253744 1:22076799-22076821 AAGGGAAAGGAGAAGGAAAAAGG + Intronic
903670527 1:25032928-25032950 CAGGGAGACCAGAATGTGAATGG - Intergenic
903944015 1:26950607-26950629 CTGGGAGAGCAGCAGGTGAGGGG + Intronic
904344969 1:29861771-29861793 CATGGAGGACACAAGGAGAAAGG + Intergenic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
904920136 1:34000976-34000998 GAAGGAGGGGAGAAGGAGAAAGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
904998298 1:34648349-34648371 CAGGGACAGGACAAGGTGAATGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905816155 1:40952615-40952637 CAGCGGGAGCAGAACGGGAATGG + Intergenic
905850991 1:41274818-41274840 CAGGGTGAGGAGAAAGAGAGGGG - Intergenic
905975479 1:42170991-42171013 GAGGGGGAGCAGATGGTGAACGG - Intergenic
905980561 1:42222001-42222023 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
906092587 1:43194540-43194562 GAAGGAGAGGAGAAAGAGAAAGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906533371 1:46536704-46536726 GAAGGAGAGGAGAAAGAGAATGG - Intergenic
906541811 1:46592627-46592649 CAGGGAGAGCAGGGAGAGCAAGG + Intronic
906771781 1:48491542-48491564 CAGGCTGAGCAGAAAGAGATAGG + Intergenic
906857725 1:49326499-49326521 CAGGGATAGTATAAAGAGAAGGG + Intronic
907184030 1:52595330-52595352 CAGGGGGAGCAGATGAGGAATGG + Intergenic
907289049 1:53401156-53401178 GAGGGAGAGAAGAGGGAGCAGGG + Intergenic
907459591 1:54597449-54597471 CAAGGGGAGGAGGAGGAGAAAGG - Intronic
907646617 1:56250951-56250973 CATGGGGAGTAGAAGCAGAAAGG - Intergenic
907705353 1:56827846-56827868 CCTGAAGAGCAGAAGGATAATGG + Intergenic
907710449 1:56875933-56875955 CAGTGAGAACAGAAAGAGAATGG + Intronic
907749382 1:57247386-57247408 CAGTCATGGCAGAAGGAGAAGGG - Intronic
907859522 1:58338279-58338301 GAGGGAGAGCAGGAGGAGGGAGG - Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908525102 1:64980417-64980439 GAGGGAGGGCAGAGGGAAAATGG - Intergenic
908611489 1:65865676-65865698 GAGGAAGAGCAGAAGCAGAGTGG - Intronic
908960036 1:69685770-69685792 CCAGGAGAGGAGAAGGAGTATGG + Intronic
909207269 1:72775142-72775164 AAGGGAGAGTAGCAGGAGATGGG + Intergenic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909498272 1:76304331-76304353 GAGGGAGAGTGGAGGGAGAAAGG - Intronic
909596060 1:77407489-77407511 TGGGGAGAGGAGAAGGAAAAGGG + Intronic
910180350 1:84476373-84476395 GAGGGGGAGAAGAAGAAGAAGGG - Intergenic
910239365 1:85069766-85069788 CTGGGATAGCATATGGAGAAGGG + Intronic
910438500 1:87229213-87229235 GAGGGAGAGGAGAAAGAGATGGG + Intergenic
910705858 1:90128948-90128970 CAGGGACAGAAGAGTGAGAATGG - Intergenic
910806184 1:91191632-91191654 AAGGAACAGCAAAAGGAGAAAGG - Intergenic
911122130 1:94307117-94307139 CAAGCATAGCAGAAGGAGAAAGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
911958544 1:104269353-104269375 CAGGGAGAGGAGAAAGGAAAGGG - Intergenic
911968532 1:104399220-104399242 TAGGGAGAGAAGCAGGGGAATGG + Intergenic
912449520 1:109760586-109760608 CAGGCAGAGCAAGAGGAGGATGG - Intronic
912969363 1:114266086-114266108 CAGGAAGAAGAGAAGGAAAAAGG + Intergenic
912976143 1:114332005-114332027 AAGGGTGAGCAAAAGGTGAAAGG - Intergenic
913212923 1:116596383-116596405 CAGGGAGAGCAAAAGAAGAGAGG + Intronic
913248426 1:116890891-116890913 TGGGGAGAGCAGAAGGATCAAGG - Intergenic
913942268 1:125119618-125119640 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
914096277 1:144546803-144546825 GCGGAAGAGCAGAAGGAGACTGG - Intergenic
914302239 1:146387160-146387182 GCGGAAGAGCAGAAGGAGACTGG + Intergenic
914331518 1:146675045-146675067 CAGTAAGAGAAGAAAGAGAAAGG - Intergenic
914815214 1:151058122-151058144 GAGGGGGAGGAGAAGGAGAGAGG + Exonic
914960117 1:152197545-152197567 GAGGAAGAGAAGAGGGAGAAAGG - Intergenic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915548313 1:156616386-156616408 CAGTGAGGACAGAATGAGAAAGG - Intergenic
915654672 1:157349431-157349453 CAGTCAGAGCAGAAGGCAAAGGG + Intergenic
915732171 1:158061416-158061438 CAGGGAGATCAAAAAGGGAAAGG + Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915865949 1:159499568-159499590 TAGGAAGAACAGATGGAGAAAGG - Intergenic
916107724 1:161443106-161443128 GAGGGAGAGCGGAGGGAGAGAGG - Intergenic
916109308 1:161450479-161450501 GAGGGAGAGCGGAGGGAGAGAGG - Intergenic
916110895 1:161457910-161457932 GAGGGAGAGCGGAGGGAGAGAGG - Intergenic
916112481 1:161465270-161465292 GAGGGAGAGCGGAGGGAGAGAGG - Intergenic
916114065 1:161472687-161472709 GAGGGAGAGCGGAGGGAGAGAGG - Intergenic
916115235 1:161480368-161480390 GAGGGATAGCAGAGGGAGAGAGG - Intergenic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916612881 1:166410202-166410224 GAGGGCGAGCAGAAGCAGAGTGG - Intergenic
916718515 1:167464665-167464687 CAGGGTGAGTAGAAGAAGAGGGG + Intronic
916851965 1:168712994-168713016 GAGGGAGGGGAGAAGGGGAAAGG + Intronic
916953483 1:169807134-169807156 TAGGGAGAGCAGCATGAGACAGG - Intronic
917173738 1:172207561-172207583 CAGGGAGAGCAACAGGAGAAAGG + Intronic
917199458 1:172499697-172499719 GAGGGAGAGTGGGAGGAGAATGG + Intergenic
917644727 1:177018719-177018741 CAGGGAGAGAGGAAAGAGAAAGG + Intronic
917789367 1:178489559-178489581 CAGGGACAGAACAAGGACAATGG + Intergenic
917798932 1:178552917-178552939 CAGGGAGAGAACAGGGAGCAAGG + Intergenic
918081976 1:181214738-181214760 CAGGCAGAGCATGAGGTGAAGGG - Intergenic
918095446 1:181330329-181330351 CAGGCAGAGAAGAAGGGGAGAGG - Intergenic
918573827 1:186031607-186031629 AGAGGAGAGGAGAAGGAGAAAGG - Intronic
918586375 1:186193302-186193324 GAGGGAGAAGGGAAGGAGAAAGG + Intergenic
919919606 1:202160333-202160355 CAAGGAGAGCAGAGGCTGAAGGG - Intronic
919925537 1:202189994-202190016 CAGGGAGGGCATATGGAGAAAGG + Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920081695 1:203379512-203379534 CAAGGACAGAAGAAGGAGATGGG - Intergenic
920203737 1:204276569-204276591 CACACAGAGCAGAAGGAGACTGG - Intronic
920259617 1:204679975-204679997 GAGGGAGGGAAGGAGGAGAATGG + Intronic
920318228 1:205095618-205095640 ATGTGAGAGCAGAAAGAGAATGG + Intronic
920771768 1:208893120-208893142 CAGGGAGAGGAAAAAGAGAAAGG - Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
921734508 1:218612013-218612035 AAAGGAGAGGAGAAGGAGAAGGG - Intergenic
921933211 1:220772352-220772374 CAGGAAGAGCACAATGAAAAGGG - Intronic
922022122 1:221716007-221716029 CAGGGAGAGAAGAGGGAGAGGGG - Intronic
922471131 1:225877993-225878015 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
922886094 1:229021870-229021892 CAGTGAGAGAAGAAGGACACTGG + Intergenic
923235761 1:232031362-232031384 AAGGGAGAGGGAAAGGAGAAGGG + Intronic
923290998 1:232545972-232545994 CAGTGACACCAGAAAGAGAAGGG - Intronic
923369337 1:233295267-233295289 TATGGAGGGAAGAAGGAGAAAGG - Intronic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
923913979 1:238482181-238482203 CAAGGACAGCAGATGGAAAAAGG - Intergenic
924279521 1:242422210-242422232 GAGGGAGGGCAGGAGGAGAAGGG + Intronic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
924524640 1:244835445-244835467 GCGGGAGAGCGGAAGGAGATGGG - Exonic
924583677 1:245343410-245343432 CTGGCAGAGCAGAGGCAGAATGG - Intronic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063386645 10:5620221-5620243 CAGGGAGGGGGGATGGAGAATGG + Intergenic
1063424551 10:5941217-5941239 ACGGGAGAGATGAAGGAGAAAGG + Intronic
1063501589 10:6560028-6560050 AGGGGAGAAGAGAAGGAGAAAGG - Intronic
1063650125 10:7927276-7927298 AATGGAGAGAAGAATGAGAATGG - Intronic
1064247696 10:13682376-13682398 CAGGAAGCTCAGGAGGAGAAGGG + Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1064850843 10:19707077-19707099 GAGGAAGAGGAGGAGGAGAAGGG - Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065841253 10:29703368-29703390 CAGGTGGTGGAGAAGGAGAAAGG - Intronic
1066221708 10:33341448-33341470 TAGGGAGAGAAGCAAGAGAATGG - Intergenic
1066223954 10:33364050-33364072 CAGAGAGAGCAGACAGACAAAGG - Intergenic
1066495223 10:35935986-35936008 TAGATAGAGAAGAAGGAGAAAGG - Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067324013 10:45249181-45249203 CAGGAAGAGCTGCAGGAGCAGGG - Intergenic
1067521607 10:47011744-47011766 CAGGAAGAGCTAAAGGAGAGAGG - Intergenic
1067523049 10:47022410-47022432 GAGGGAGAGCAGGAGAAGAGGGG + Intergenic
1067836128 10:49642913-49642935 CAGGGAGTGCTGAAGGATCATGG - Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068329683 10:55546868-55546890 CAGGGAAAGATGAAGGGGAAAGG + Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068601996 10:58966464-58966486 CTGGGAGAGTAGAATGTGAAGGG - Intergenic
1068719419 10:60227509-60227531 CAGGCAAAGGAGAAAGAGAATGG - Intronic
1068761874 10:60721280-60721302 CAGGAAGAGAAAAATGAGAATGG + Intronic
1069513222 10:69057437-69057459 CAGGGAGACAATAAGGGGAAGGG - Intergenic
1069725826 10:70577662-70577684 AAGGGAGAAGAAAAGGAGAAAGG - Intergenic
1069755104 10:70769734-70769756 CAGGGAGAGAAGCAGGGGAAAGG + Intergenic
1069884484 10:71615257-71615279 CACAGAGACCAGAAGGAGATTGG + Intronic
1070160038 10:73860928-73860950 CAAGGTGACCACAAGGAGAATGG - Intronic
1070165382 10:73893675-73893697 CAGGGAAAGTATAAGGAGCAAGG - Intergenic
1070710194 10:78675703-78675725 CAGGGAGGGCAGCAGGAGCCAGG - Intergenic
1070731266 10:78830150-78830172 TAGAGAGGGCAGAAGGGGAATGG - Intergenic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072169024 10:92842530-92842552 AAGGGAGAGGAAAGGGAGAAAGG + Intronic
1072288551 10:93940800-93940822 GAGGAACAGCAGAAGGCGAAAGG - Intronic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1072439892 10:95445056-95445078 CTGAGAGGGTAGAAGGAGAATGG + Intronic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073184773 10:101609274-101609296 TAAGGGGATCAGAAGGAGAAGGG + Intronic
1073592143 10:104767660-104767682 AAGGGAGTGGAGAAGGGGAAGGG - Intronic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1073779307 10:106819764-106819786 CAGGAAGAACAGAAAGATAAGGG + Intronic
1073978863 10:109131555-109131577 GAGGGTGAGCCGAAGCAGAATGG + Intergenic
1074339504 10:112613473-112613495 CAGAGAGGGGAGAAGGTGAAAGG - Intronic
1074461350 10:113640338-113640360 CAGGAAGAAAAGAAGAAGAATGG + Intronic
1074918872 10:117986662-117986684 AAGGGAGAGAGGGAGGAGAATGG + Intergenic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075450613 10:122549524-122549546 GAGGGAGAGGAGAAGGGGACAGG + Intergenic
1075625906 10:123964413-123964435 CAAGGAGAGGAAAAGGAAAAGGG + Intergenic
1075663503 10:124214676-124214698 CAGGCAGAGCAGGAAGAGGAGGG + Intergenic
1075940277 10:126385727-126385749 TAGGGTGAGCAAAGGGAGAATGG + Intronic
1076097632 10:127744915-127744937 CAGGGAGTGCAGCAGGAAAGGGG - Intergenic
1076122593 10:127948132-127948154 CCAGGAGAGCAGATGGGGAAGGG + Intronic
1076252348 10:128994583-128994605 CAGGGGGAGGTGGAGGAGAAAGG + Intergenic
1076252369 10:128994663-128994685 GAGGGAGAGAGGAAGGAGAGGGG + Intergenic
1076304188 10:129452159-129452181 AAGGAAGAGCAGAAGGACATGGG + Intergenic
1077726824 11:4683105-4683127 CAGGGAAAGTAAAATGAGAAAGG - Intronic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078332416 11:10436164-10436186 CAGGGGGACAAGAAGGCGAAAGG + Intronic
1078546337 11:12249672-12249694 CAGTGAGAGCAGAATGTGCAGGG - Intronic
1078891695 11:15563466-15563488 CAGGGAGGGTAGGGGGAGAACGG + Intergenic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1079719815 11:23795914-23795936 GAGAGAGAGAAGAAAGAGAAAGG - Intergenic
1079753655 11:24229223-24229245 CAGGGGCTGCAGAAGGATAAAGG - Intergenic
1079843331 11:25430946-25430968 CAGTGAGAACACATGGAGAAAGG + Intergenic
1079892875 11:26079945-26079967 GAGGGAGAGGAGAGGGAGAGGGG + Intergenic
1080288830 11:30647508-30647530 CAGGGAGAGAGGGAGGAAAAAGG - Intergenic
1080922327 11:36721463-36721485 CAGTGAGAGCAGTGAGAGAAGGG - Intergenic
1081007151 11:37759094-37759116 GTGGAAGAGCAGAAGGAAAAAGG - Intergenic
1081085645 11:38796913-38796935 CAATCAGAGCAGAAGGGGAAAGG - Intergenic
1081305645 11:41508755-41508777 CAGGGAGAAGAGCACGAGAAAGG + Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081969373 11:47187170-47187192 TAGGGAGAGAGGAGGGAGAAGGG - Intergenic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082812880 11:57489221-57489243 CAGGGAGAGGGGAAGGATGAAGG + Intronic
1082833824 11:57638391-57638413 CAGGGAGTGTGGAAGGAGAAAGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083811549 11:65109401-65109423 GCGGGAGAGCAGCAGGAGCAGGG - Exonic
1083874799 11:65516319-65516341 CAGAGAGAGGAGAGAGAGAAAGG + Intergenic
1084005843 11:66323082-66323104 CAGGCAAAGCAGGAGAAGAAAGG + Intergenic
1084162770 11:67359090-67359112 CATGGTGGGCAGAAGTAGAAGGG - Intronic
1084308100 11:68299557-68299579 GAGGAAGAGCTGAAGGGGAAGGG + Intergenic
1084400579 11:68940689-68940711 CAGAGAGGTCAGAAGGAGAGGGG - Intergenic
1084476082 11:69390565-69390587 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
1084514668 11:69630125-69630147 CAGGAAGAGGAAAAGGAGAAGGG + Intergenic
1084609267 11:70191811-70191833 TAGGGAGGGCCCAAGGAGAACGG + Intergenic
1084637400 11:70400961-70400983 ATGGCAGAGCAGGAGGAGAAAGG - Intronic
1084793368 11:71489051-71489073 CAGAGAGAGCAGGAGGGGAGGGG + Intronic
1084960844 11:72715522-72715544 CAGGCAGAGAACAGGGAGAAGGG - Intronic
1084999837 11:73021980-73022002 GAGGGAGAGGAGAATGAGATGGG + Intronic
1085050806 11:73379250-73379272 GAGGGGGAGCAAGAGGAGAAGGG + Intronic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085263996 11:75225587-75225609 CAGAGAGAGCAGGAGGGGAGTGG - Intergenic
1085299275 11:75449041-75449063 CAGGGAGAGGAGATGGTGAGAGG + Exonic
1085309369 11:75507110-75507132 CAGGGAAAGAAAGAGGAGAAGGG + Intronic
1085310589 11:75514292-75514314 GAGGGGGAGAAGCAGGAGAAGGG + Intronic
1085324888 11:75598956-75598978 CAGGTGGAGAAGCAGGAGAAGGG + Intronic
1085447562 11:76610872-76610894 CAAGGCGAGCGGAGGGAGAAGGG - Intergenic
1085514608 11:77105070-77105092 CAGGAAGAGCTCAAGCAGAAGGG - Intronic
1085638287 11:78174751-78174773 TAGGGAGAGGGAAAGGAGAAAGG + Intronic
1085778846 11:79390343-79390365 GAAGAAGAGCAGAAGGGGAAGGG - Intronic
1086770593 11:90760219-90760241 CATGCAGAGTAGAAGGAGATGGG + Intergenic
1086926747 11:92648940-92648962 AAGGGAGAGCAGAAGGAGAGGGG - Intronic
1087093674 11:94300151-94300173 GAGGGAGAGGAGAGAGAGAAGGG + Intergenic
1087466617 11:98515706-98515728 AAGGGAGACCAGCAGGAGAGTGG + Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087680045 11:101210156-101210178 CAGGGAGTGCAGATGGACAGTGG - Intergenic
1088158215 11:106835463-106835485 GAGGGAGAGAATAAAGAGAATGG + Intronic
1088591958 11:111411232-111411254 GGAGGAGAGTAGAAGGAGAAAGG - Intronic
1088678904 11:112222331-112222353 CAGGAAGAGAAGAAGAAGAAAGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1088854502 11:113735005-113735027 CATGGAGAGCATTTGGAGAAGGG + Intronic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1089100403 11:115958195-115958217 TAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1089170535 11:116508406-116508428 CAGGTAAAGATGAAGGAGAAAGG - Intergenic
1089184782 11:116607387-116607409 GAGGGACAGGAGAAGGAAAAGGG - Intergenic
1089201754 11:116728822-116728844 CAAAGAGAGGAGATGGAGAAGGG + Intergenic
1089275762 11:117335044-117335066 TAGGGAGAGGAGAAGAAAAAAGG - Intronic
1089624092 11:119740403-119740425 GAGGGAGATCAGAAAGAGAAAGG - Intergenic
1089667558 11:120030065-120030087 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
1089747147 11:120625380-120625402 CACAGAGAGAAGAAGCAGAAAGG + Intronic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090238721 11:125166981-125167003 CAGAGAGAGCAGGAGGGCAAGGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090623553 11:128584878-128584900 GAGAGAGAGAAGAAGAAGAAAGG + Intronic
1090631159 11:128649838-128649860 AAGGGAGAGGAGGAGGAGAAGGG + Intergenic
1090867744 11:130716924-130716946 CAGGTGGAGGAGAAGGTGAAGGG - Exonic
1091250667 11:134141438-134141460 CAGGGAGAGAGGGAGGAGAGGGG + Intronic
1091517414 12:1198722-1198744 CAGTCATAGCAGAAGGTGAAGGG + Intronic
1091611083 12:2010326-2010348 GAGCCAGAGCAGAATGAGAAGGG + Intronic
1091688726 12:2581652-2581674 GAGGAAGAGGAGAAGGAGCAGGG - Exonic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1091759092 12:3075760-3075782 AAGGGAGATCAGAAGGAAATGGG + Intergenic
1092505093 12:9090516-9090538 GAAGGAGAACAGAGGGAGAATGG + Intronic
1092967228 12:13656038-13656060 CAGGCAGAGAAGCAAGAGAACGG - Intronic
1092982148 12:13807429-13807451 CAGGGAGGTGAGAAGGAGAAGGG - Intronic
1093052806 12:14522148-14522170 GAGGGAGAAGAGATGGAGAAGGG + Intronic
1093766885 12:22973947-22973969 AAAGGAGAGTAGGAGGAGAAAGG - Intergenic
1094083798 12:26566327-26566349 GAGGGAGAGGAGAAGGAGAAGGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094166167 12:27446261-27446283 CAGAGGGAGCAGGAGGGGAAGGG + Intergenic
1095173724 12:39065486-39065508 AAGAGAGAGCAGAGAGAGAAAGG - Intergenic
1095296138 12:40529830-40529852 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1095421533 12:42029072-42029094 TTGGGAGAGCAAAAGGAAAAAGG - Intergenic
1095429646 12:42119427-42119449 CAGAAAGAGAAGAAAGAGAAAGG + Intronic
1095566445 12:43629474-43629496 GAAGGAGAGGAGAAAGAGAATGG - Intergenic
1095715240 12:45338336-45338358 AAGGGACAGCAGAAGGTGAGGGG + Intronic
1096142591 12:49254727-49254749 CAGGGAGGGGAGAAGGACTAGGG - Intronic
1096243319 12:49970990-49971012 CAGGGAGAACAGAAGGAAATGGG + Intronic
1096443014 12:51662006-51662028 CAGGCAGAGCAGCAGCAGAAGGG - Intronic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1096751029 12:53758996-53759018 CAGGGAGAAGAGAAGCAAAAAGG - Intergenic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1096875241 12:54624893-54624915 AAGGAAGGACAGAAGGAGAAGGG - Intergenic
1097151123 12:56980729-56980751 CAGAGAAAGCATTAGGAGAAAGG - Intergenic
1097241511 12:57578680-57578702 CAGGGAGATGAGAAGAAGCAAGG + Intronic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097680795 12:62647259-62647281 CAGGGAGCACAGCATGAGAATGG + Exonic
1097707224 12:62880800-62880822 CAGGGCGAGCACCTGGAGAAGGG - Intronic
1098105897 12:67069049-67069071 CAGGCAGAGGAGCAGGAGAGAGG - Intergenic
1098335872 12:69403898-69403920 AAGAGAGAGAAGAAAGAGAAAGG - Intergenic
1098415621 12:70231417-70231439 GAGGGAGAGAGGAAGGAAAAAGG - Intergenic
1098520138 12:71426113-71426135 AAGGAAGAGAGGAAGGAGAAAGG + Intronic
1098606544 12:72397558-72397580 AGGGGTGAGCACAAGGAGAATGG - Intronic
1098685004 12:73408792-73408814 GAGGGAGAAGAGAAGAAGAAAGG + Intergenic
1098772765 12:74575404-74575426 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1098843231 12:75503021-75503043 CATGCTGAGCAGAAGTAGAAAGG + Exonic
1098911340 12:76212130-76212152 CTGGGAGACCAGGAGGATAAGGG - Intergenic
1099215165 12:79844581-79844603 CAAGGACAGAAGTAGGAGAAGGG - Intronic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1100043893 12:90355199-90355221 CAGGGAGAAAAGACTGAGAATGG + Intergenic
1100164389 12:91900174-91900196 GAGAGAGAGCAAAAGGGGAATGG - Intergenic
1100236742 12:92669238-92669260 GAGGGAGGGGAAAAGGAGAATGG + Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100301264 12:93310002-93310024 CGGGGAGAGCAGGAGGAGACAGG + Intergenic
1100307992 12:93368935-93368957 GAGGGAGAGGTGAAGGAGAGAGG - Intergenic
1100552797 12:95662205-95662227 AAGGAAGAACAGAAGGAGAGGGG - Intronic
1101282022 12:103267794-103267816 CAGGAAGAGAGGAAGTAGAATGG + Intronic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101476643 12:105055952-105055974 GAAGGAGAGGAGAATGAGAAGGG + Intronic
1101694218 12:107109336-107109358 CAGAGAGAGCAGGAAGTGAAAGG + Intergenic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1102992046 12:117322489-117322511 GAGGGAGGGAAGAAGGAGAGAGG - Intronic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103219507 12:119232042-119232064 CAGGGAGGGGAGAGGAAGAAGGG - Intergenic
1103570019 12:121838835-121838857 CAGGAAGAGCGAACGGAGAAAGG - Intergenic
1103670494 12:122610697-122610719 AAGGCAGATCAGAAGGATAATGG - Intronic
1103820053 12:123690519-123690541 CAGGGACACCTGAGGGAGAAGGG - Exonic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104101352 12:125615264-125615286 TAGGAAGAGTAGAAAGAGAAAGG - Intronic
1104282718 12:127392455-127392477 AAGGGAGAGGAGGAGGAAAAAGG + Intergenic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104316236 12:127704425-127704447 GAGGAAGAGGAGAAGGAGATTGG + Intergenic
1104502645 12:129301366-129301388 CAGGGAGAGAAGGAGGTGAGAGG - Intronic
1104616394 12:130273472-130273494 AAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104782775 12:131432515-131432537 CAGGAGGAGGAGGAGGAGAAGGG + Intergenic
1105216165 13:18286982-18287004 CAGGGAGAGCAAAAGAAGAGAGG + Intergenic
1105544861 13:21343982-21344004 GAGGAGGAGAAGAAGGAGAAGGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1106933276 13:34690293-34690315 GAGGGGCAGCAGGAGGAGAAGGG - Intergenic
1107124276 13:36829342-36829364 CAGTGAGAGCTGAATGAAAAGGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107842606 13:44474716-44474738 GAGGGAGAGGAGATGAAGAAAGG + Intronic
1107976446 13:45693108-45693130 AAGGGAGATCACAAAGAGAAGGG + Intergenic
1108299783 13:49061725-49061747 GAGGGAGAGGAGAGGGAGAGGGG - Intronic
1108800115 13:54084531-54084553 CAGGGAGTGTAGAGGGAGAAGGG - Intergenic
1108928808 13:55788907-55788929 AAGGAAGAAGAGAAGGAGAAAGG - Intergenic
1109293661 13:60504784-60504806 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1109341363 13:61064672-61064694 CAGTTATGGCAGAAGGAGAAGGG + Intergenic
1109485806 13:63017216-63017238 CATGGAGAGCAGAAGGAATTAGG + Intergenic
1109554630 13:63955820-63955842 AAGGGAGAGCAAAGGGAGTATGG - Intergenic
1109661682 13:65467716-65467738 GAGGGCGAGCAGAAGCAGAGCGG - Intergenic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110119309 13:71864429-71864451 CAAGGAGACCAGAAGGACATTGG - Intronic
1110515820 13:76411407-76411429 AAGGGGGAGGAGGAGGAGAAAGG + Intergenic
1110515889 13:76411554-76411576 GAGGGGGAGGAGGAGGAGAAGGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111444603 13:88330827-88330849 GAGGGAAAGAAGAAGGAGAAGGG - Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111643649 13:91002592-91002614 CAGGAACAACAGAAAGAGAAAGG - Intergenic
1111785334 13:92779124-92779146 CAATCACAGCAGAAGGAGAAAGG + Intronic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1113105700 13:106769722-106769744 AAGGGAGAGAAGAAGGATTAGGG + Intergenic
1113127860 13:107000222-107000244 CAGCAAGAGCTGGAGGAGAAGGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113373473 13:109742940-109742962 AAGAGAGAGAGGAAGGAGAAGGG + Intergenic
1113496857 13:110737764-110737786 CAATCATAGCAGAAGGAGAAGGG - Intergenic
1113611400 13:111647071-111647093 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1113710696 13:112462621-112462643 GAAGGAGAGGAGAAAGAGAATGG + Intergenic
1114485003 14:23057114-23057136 GAGGGAGAGGAGATGGAAAAAGG + Intronic
1114657030 14:24322478-24322500 CAGGGAGTGAAGGAGAAGAAAGG + Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1114911147 14:27199450-27199472 AAGGGAGTGAGGAAGGAGAAAGG - Intergenic
1115684746 14:35784673-35784695 CATGGAGATCAGACTGAGAAAGG + Intronic
1115970835 14:38943146-38943168 CAGGTACAGAAGAAGGAGAATGG + Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116065871 14:39982380-39982402 CAGGGAGAGGAGAGGAAAAAGGG + Intergenic
1116499942 14:45608262-45608284 GAGGGATAGCATTAGGAGAAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117432728 14:55685503-55685525 TAGGGAGGGCAGAAGGATAGCGG - Intronic
1117654379 14:57939463-57939485 CCTGGAGACCAGAAGAAGAAAGG + Intronic
1117911511 14:60642164-60642186 CAGGAAGCGAAGAAGGAGACAGG + Intergenic
1118508716 14:66445840-66445862 GAGGGAGAGAGAAAGGAGAAAGG - Intergenic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118708169 14:68499069-68499091 CAAGAAGAGGAGAAGGTGAAGGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119567187 14:75638665-75638687 GAGGGATGGGAGAAGGAGAAAGG + Intronic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1119995398 14:79248233-79248255 AAGGGAGAGCAGATGAAGAAGGG - Intronic
1120159618 14:81131325-81131347 CAGGGAGATCAAAAATAGAAAGG - Intronic
1120286141 14:82504530-82504552 AAGGGAGGGCAGAACAAGAAAGG + Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120587004 14:86324503-86324525 CAAGGAGAGAAGAATGGGAATGG + Intergenic
1120616306 14:86709459-86709481 CAGGCAGAGCAGGAGCAAAATGG + Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121227477 14:92331804-92331826 CATTGAGAGGAGAAAGAGAAGGG - Intronic
1121624622 14:95375007-95375029 AAGGAAGAGGGGAAGGAGAAGGG - Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1122215572 14:100201545-100201567 CAGGGAGAGGAGAGGGAGATAGG + Intergenic
1123088089 14:105727372-105727394 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1123094044 14:105756745-105756767 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1123438463 15:20272753-20272775 CAGGGACAGCAGGAAGTGAACGG + Intergenic
1123989980 15:25675975-25675997 GAGGGAGAGGAGGAGGGGAAAGG + Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124239686 15:28019228-28019250 GAGGGAGAGAATAGGGAGAATGG + Intronic
1124343350 15:28904147-28904169 CAGAGATAGCAGAAAGCGAAAGG + Intronic
1124609417 15:31198132-31198154 TAGGGATAGAAGAAGGAGAAGGG - Intergenic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1125482058 15:40088025-40088047 CTGGGAGAGAGGAAGAAGAAAGG - Exonic
1125514078 15:40308212-40308234 CAGGGAGCTCACTAGGAGAAAGG + Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125776192 15:42216558-42216580 CATGGAGAGCTGAAGTACAAGGG + Intronic
1125779582 15:42252560-42252582 GAGGGAGAAGAGAGGGAGAAAGG - Intronic
1125829408 15:42703301-42703323 GAGGGAGTGCAGAATGAGAACGG - Intronic
1125892186 15:43274979-43275001 GAGGGAGAGGAGGAGGGGAAGGG + Intergenic
1126362805 15:47863604-47863626 GAAGAAGAGGAGAAGGAGAAGGG + Intergenic
1126385634 15:48090599-48090621 GAGGGAGAGAAGAAGGGGCAGGG + Intergenic
1126652835 15:50943034-50943056 CAGGGAGGGCAGGAGGGGAAAGG - Intronic
1126856160 15:52841401-52841423 CAGGGAAAGAGGAAGGAAAAGGG - Intergenic
1127262349 15:57335550-57335572 GCTGGAGAGCAGAGGGAGAACGG - Intergenic
1127410705 15:58703790-58703812 CAGTCATAGCAGAAGGAGAAGGG - Intronic
1127450760 15:59114142-59114164 AAGGGAGAGAAGCAGGAGATGGG + Intronic
1127502292 15:59565567-59565589 GAAGGAGAGGAGAGGGAGAATGG - Intergenic
1127560586 15:60132541-60132563 AAGGAAGAGAGGAAGGAGAAGGG + Intergenic
1127560606 15:60132610-60132632 AAGGAAGAGAGGAAGGAGAAGGG + Intergenic
1127588752 15:60401556-60401578 GAGGCTGAGCAGCAGGAGAATGG + Intronic
1127693203 15:61418126-61418148 CAAGAAGAGGAGAAGGAGAGAGG + Intergenic
1127966799 15:63928779-63928801 CAGGCAAAGAGGAAGGAGAAAGG + Intronic
1128110368 15:65072214-65072236 CAGGAAGAGGAGGAGGAGATGGG - Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128757552 15:70193825-70193847 GAGGGGGAGCAGGGGGAGAAGGG + Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129297719 15:74609031-74609053 CAGGGAGAGCAGATGGTGTTGGG - Intronic
1129323163 15:74785935-74785957 CTGGGAGACCGGAAGGGGAATGG - Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129668015 15:77590312-77590334 CAGGGAGAGAAGAGTGAGCAGGG + Intergenic
1129763793 15:78148234-78148256 CAGGGAGAGGACAAGGGGAAAGG + Intronic
1130029212 15:80296380-80296402 GAGGGAGAGAGGGAGGAGAAAGG + Intergenic
1130226085 15:82059111-82059133 GAGGAAGAGTGGAAGGAGAAGGG - Intergenic
1130746830 15:86663354-86663376 GAGTGAGGGAAGAAGGAGAAAGG - Intronic
1130795197 15:87200351-87200373 AAAGGAGAGCAGCAGGAGTAGGG + Intergenic
1130917207 15:88314498-88314520 CAGGGTTAGCAGAAGGCCAATGG + Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1131683139 15:94744883-94744905 GAGGGAGGGAGGAAGGAGAAGGG + Intergenic
1131697346 15:94892334-94892356 CAGTCATAGCAGAAGGCGAAGGG + Intergenic
1131809501 15:96158172-96158194 CAAGGAAAGCTGGAGGAGAAAGG + Intergenic
1131828670 15:96340899-96340921 CAGGGAGAGCTAATGGTGAAAGG - Intergenic
1131849182 15:96519767-96519789 GAGGGAGAAGAGATGGAGAATGG + Intergenic
1132055356 15:98647814-98647836 CAGGGGGAGCGGAGGGGGAAGGG - Intergenic
1132059997 15:98684697-98684719 ATGAGAGAGTAGAAGGAGAAAGG + Intronic
1132156134 15:99496368-99496390 CAGGGAGGGCAGAAGGACAGAGG + Intergenic
1132271336 15:100528680-100528702 GAGGGAGAGGAGATGGAGATTGG - Intronic
1132574622 16:658738-658760 CAGGGAGAGCAGAAGGTGAGGGG + Intronic
1132605721 16:792952-792974 CAGGGAGACCTGGTGGAGAAGGG - Exonic
1132726635 16:1341739-1341761 CAGGGAGTCCAGAAGCAGCAGGG - Intronic
1133036876 16:3038508-3038530 CACGGAGTGCAGAGGTAGAAGGG + Intergenic
1133116871 16:3582481-3582503 CAGGCAGAGCTGAGGCAGAACGG - Exonic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133552586 16:6871591-6871613 CCAGGAGAATAGAAGGAGAATGG - Intronic
1134031750 16:10997682-10997704 CAGGTAGAGCAGAAAGTGAAAGG + Intronic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1135471845 16:22738065-22738087 CAGGCAGAGGAGCAAGAGAAAGG + Intergenic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135861301 16:26058491-26058513 CAGGCACAGCAGGAGGTGAACGG + Intronic
1135904706 16:26500960-26500982 AAGGGAGAAGAGAATGAGAAGGG + Intergenic
1136077383 16:27826459-27826481 CTGGGGGAGCTGAAGGAGATGGG - Intronic
1136151980 16:28356843-28356865 GAGGGGGAGGAGAAGAAGAAAGG + Intronic
1136624500 16:31453734-31453756 CTGGGGGAGAAGAAGGAAAACGG + Intergenic
1136696271 16:32084465-32084487 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136796766 16:33027717-33027739 ATGGGAGAGAAGAAGGAGAGCGG - Intergenic
1136920519 16:34267532-34267554 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
1137268475 16:46886929-46886951 CAGTGAGAAGAGAATGAGAAGGG - Intronic
1137854539 16:51780723-51780745 ACAGGAGAGAAGAAGGAGAAGGG - Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138293869 16:55870359-55870381 GAGGAAGAGGAGGAGGAGAAAGG + Intronic
1138519894 16:57565011-57565033 CTGGAAGGGCAGCAGGAGAAGGG - Intronic
1138802797 16:60055211-60055233 GAGGGAGAGGTGAGGGAGAATGG - Intergenic
1139209946 16:65067713-65067735 AAGGGAGAAGAGAAGAAGAAGGG + Intronic
1139315330 16:66062699-66062721 CAGGAAGAGAGGGAGGAGAAAGG + Intergenic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139852857 16:69961399-69961421 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1139881828 16:70184307-70184329 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1139893603 16:70270485-70270507 GAGGGAGAAAGGAAGGAGAAAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1140002036 16:71035855-71035877 CAGTAAGAGAAGAAAGAGAAAGG + Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140215158 16:73001153-73001175 AAGGGAGAGGAGGAGGAGAAGGG - Intronic
1140247795 16:73267168-73267190 GCGGAAGGGCAGAAGGAGAAGGG + Intergenic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140370682 16:74411199-74411221 CAGGGAGAAGAGAAGCAGACGGG - Intronic
1140596154 16:76416066-76416088 CATGGATATCAGAAGAAGAAAGG - Intronic
1140731217 16:77858306-77858328 AAGGGAGGGCATAATGAGAAGGG + Intronic
1140805962 16:78532661-78532683 CAGTGATGGCAGAAGGTGAAAGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1140903634 16:79392435-79392457 AAGAGAGAGGAGGAGGAGAAGGG + Intergenic
1140976482 16:80064537-80064559 CAGGGAGAGTTGAGAGAGAAGGG - Intergenic
1141047007 16:80724260-80724282 GAGGAAGAGGAGGAGGAGAAAGG + Intronic
1141155505 16:81594021-81594043 GAGGGGGAGGAGGAGGAGAAGGG - Intronic
1141171769 16:81696181-81696203 AAGGCATAGCAGAAGGAGAAAGG + Intronic
1141627760 16:85270308-85270330 CAGGGAGAGCAGCAGGTCACTGG - Intergenic
1141775567 16:86120891-86120913 GAGGAAGAGGAGGAGGAGAAGGG - Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141855688 16:86679872-86679894 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1141942515 16:87286970-87286992 AAGGGAGAGGAGCGGGAGAAGGG + Intronic
1142251414 16:88993677-88993699 GAGGAAGAGAAGAAGGGGAAAGG - Intergenic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142601877 17:1057106-1057128 GAGGGAGAGCCGAGAGAGAAGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143407024 17:6684394-6684416 CATGGCTAGCAGAAGGAGCAGGG + Intergenic
1143416863 17:6756718-6756740 CAGGAAGAGCAGGGGGAGAAGGG + Intronic
1143647403 17:8239855-8239877 GAAGGAGAGCAGATGCAGAAGGG - Intronic
1143921153 17:10331998-10332020 CAGGTGGACCAAAAGGAGAAGGG + Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144580437 17:16456077-16456099 GAGGGAGAGGAGGAGGAGGAAGG + Intronic
1144652446 17:17015572-17015594 CAAGGAGAGCAGTAAGGGAACGG + Intergenic
1144746803 17:17621448-17621470 AAGGGGGAGGAGGAGGAGAAGGG + Intergenic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145214612 17:21042518-21042540 AAGAGAGGGCAGAAGGAGAGAGG + Intronic
1145690207 17:26731759-26731781 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1145840431 17:27989697-27989719 CAGGGAGAACAGAAGGCAAGTGG - Intergenic
1146013317 17:29213065-29213087 CTAGGCGAGCAGAAAGAGAATGG - Intergenic
1146123726 17:30216265-30216287 AGGGGAGGGGAGAAGGAGAAGGG + Intronic
1146291771 17:31612906-31612928 AAAGGAGAGGAGAAGGAGGAGGG - Intergenic
1146430991 17:32794729-32794751 CAGAGAGAGCATAGGGAGAGAGG + Intronic
1146456444 17:33013296-33013318 CAGGGAGAGAAGAACGACATGGG + Exonic
1146619882 17:34389062-34389084 CAGGGAGAGGGGAAGGAGCATGG + Intergenic
1146911645 17:36652099-36652121 GAGGGAGAGAAAAAAGAGAAAGG - Intergenic
1146979508 17:37146707-37146729 AAGGGAGAGAAGAAGGAGGGGGG + Intronic
1147261325 17:39211059-39211081 CCTGGAGAGAAGCAGGAGAAAGG + Exonic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148387352 17:47243867-47243889 AAGAGAGAGAAGAAAGAGAAAGG - Intergenic
1148562046 17:48611878-48611900 TTGGGGGAGCAGGAGGAGAAGGG - Intronic
1148638794 17:49169491-49169513 GAGGGAGAGCAGAAGGAAGTGGG - Intronic
1148679727 17:49466671-49466693 CTGGGAGAGAAGGAGGGGAAGGG + Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1148807790 17:50273008-50273030 CTGGGAGAGATGAGGGAGAAGGG + Intronic
1148874816 17:50680684-50680706 CTGAGAGAGAAGAAAGAGAAGGG - Intronic
1148889063 17:50794659-50794681 CCTGGAGAGAACAAGGAGAATGG - Intergenic
1149114081 17:53070629-53070651 CAGAGACTGCAGAAGGAAAATGG - Intergenic
1149190946 17:54061011-54061033 CAGCCAGAGAAGAAGGAGTAAGG - Intergenic
1149307623 17:55364302-55364324 AAGAGAGGGCAGAAGGACAAAGG + Intergenic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1149512193 17:57252665-57252687 CAAAAAGAGCAGAAGCAGAAGGG + Intergenic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1150184986 17:63170953-63170975 AATGGAGATCAGAAGCAGAAAGG - Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1151055320 17:71023930-71023952 GTGGGAGTGCAGAAGGAGCACGG - Intergenic
1151227514 17:72657996-72658018 CAGGCACGGCAGAAGCAGAAGGG + Intronic
1151294684 17:73176151-73176173 CTGGGAGGGCAGAAGAAGCATGG - Intergenic
1151321417 17:73354791-73354813 CAGAGGGTGCAGAAGCAGAACGG - Intronic
1151456087 17:74226573-74226595 TCGGGACAGCAGCAGGAGAAGGG + Intronic
1151636335 17:75351081-75351103 CAGGAAGATCAGGTGGAGAAGGG + Intronic
1151671029 17:75571796-75571818 CAGGGAGAGCAGAGGGTGCTCGG + Intronic
1151969624 17:77451012-77451034 CAGGCAGAGCACAAGGAGAGAGG + Intronic
1152208670 17:78991044-78991066 CCGGGAGAGCGGAATCAGAAAGG - Intergenic
1152524451 17:80879503-80879525 CAGTGAGGGAAGAAGGGGAAGGG - Intronic
1152565126 17:81096954-81096976 GAGGAGGAGAAGAAGGAGAAAGG + Intronic
1152609234 17:81307473-81307495 AAGGGGGAGGGGAAGGAGAAAGG - Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153000936 18:454726-454748 TAGGGAGAGGACAAGGACAAGGG - Intronic
1153006843 18:504638-504660 CAGGGAGAAAAGAAGGGAAAAGG + Intergenic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1153580829 18:6571664-6571686 CAGAGAGAGTGGAAGAAGAAAGG - Intronic
1153624235 18:7008131-7008153 CATAGAGACCAAAAGGAGAATGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1154098391 18:11443077-11443099 GAGGGAGAGAAGAAAGAAAATGG - Intergenic
1155068929 18:22295876-22295898 AAGGGAAAGCAGAAGAGGAAAGG - Intergenic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155170727 18:23265220-23265242 ATGAGAGAGCAGGAGGAGAACGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1156129761 18:33957155-33957177 CAGGAAGATGAAAAGGAGAAGGG + Intronic
1156679761 18:39574008-39574030 GAGGCTGAGCAGCAGGAGAACGG + Intergenic
1156747534 18:40410629-40410651 TTGTTAGAGCAGAAGGAGAAAGG - Intergenic
1157145554 18:45158977-45158999 GAGGGAAAGGAGGAGGAGAAAGG - Intergenic
1157289289 18:46398588-46398610 CAGGGAGAGTGGGAAGAGAAGGG + Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157539089 18:48486501-48486523 GAGGAAGAGCAGGATGAGAAGGG - Intergenic
1157913383 18:51640090-51640112 CGGGGAGGGCAGTAGGAGACTGG + Intergenic
1158050857 18:53217512-53217534 CAGAGAGAGAAAAAGGAGAGAGG - Intronic
1158371048 18:56804976-56804998 CAGGGAGAACAAATGCAGAAGGG - Intronic
1158775001 18:60567290-60567312 CATGGAGAGCAAAGTGAGAATGG + Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1160333325 18:78015143-78015165 CAGGGAGAGGGGCTGGAGAAAGG - Intergenic
1160360212 18:78268679-78268701 CAGGAAGAGAAGGAGGTGAAGGG - Intergenic
1160394981 18:78564317-78564339 TAGGGAGGGGAGGAGGAGAAGGG - Intergenic
1160394997 18:78564359-78564381 TAGGGAGAGGAGGAAGAGAAGGG - Intergenic
1160395010 18:78564401-78564423 TAGGGAGAGGAGGGGGAGAAGGG - Intergenic
1160965734 19:1746195-1746217 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160965798 19:1746366-1746388 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1161112441 19:2477747-2477769 GAGGAAGAGGAGGAGGAGAAGGG + Exonic
1161200010 19:3009432-3009454 AAGGGAGTGCAGAAAGGGAAGGG - Intronic
1161501447 19:4618284-4618306 GAGAGAGAGAAGAATGAGAAAGG - Intergenic
1161648078 19:5466756-5466778 AGGGGAGAGGAGAAAGAGAAGGG + Intergenic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161876452 19:6914949-6914971 TGGTGAGAGCAGTAGGAGAAAGG + Intronic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162082237 19:8225104-8225126 CAGGGAGAGCAGATGGTGTGAGG + Intronic
1162479711 19:10921227-10921249 CAGGAAGAGGAAAAGGTGAAAGG - Intronic
1162508140 19:11100198-11100220 GAGAGAGAGGAAAAGGAGAAAGG - Intronic
1162690508 19:12426029-12426051 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1162875603 19:13618867-13618889 GAGGGAGGGAGGAAGGAGAAGGG + Intronic
1162875644 19:13618999-13619021 GAGGGAGGGAGGAAGGAGAAGGG + Intronic
1162875650 19:13619017-13619039 AAGGGAGGGAGGAAGGAGAAGGG + Intronic
1162896123 19:13765487-13765509 CAGGGAGGGCTGGAGCAGAAAGG - Intronic
1162984105 19:14258321-14258343 GAGGGGGAGGAGAAGAAGAAGGG - Intergenic
1163206079 19:15803538-15803560 GAAGGAGAGGCGAAGGAGAAAGG + Intergenic
1163326302 19:16605575-16605597 CAGAGAGAGCAGCAGGAAAGGGG + Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163622502 19:18369291-18369313 GAGAAAGAGCAGGAGGAGAAAGG - Exonic
1163738671 19:18997292-18997314 CTGGGAGAGGAAAGGGAGAAGGG + Intronic
1164501259 19:28822188-28822210 CAAGGAGACCAGAATGAGAAAGG + Intergenic
1164531961 19:29055590-29055612 CAAGGAGAGAGGAAAGAGAAAGG - Intergenic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1165134906 19:33661654-33661676 CAGGGGGAGCCAAAGGAGCAAGG - Intronic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165197743 19:34118154-34118176 GAGGAAGAGGAGAAGGACAAGGG + Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165375231 19:35437160-35437182 CACGGACAGCAGATGGAGAAGGG + Intergenic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1165777536 19:38413466-38413488 CAGGGAGAGCTGGAGCAGACAGG + Exonic
1166122493 19:40693934-40693956 CAGGGGGAGCAGAGAGGGAATGG - Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166556810 19:43705542-43705564 TAGGGAGACCAGAAAGAGAAAGG - Intergenic
1167191197 19:47991434-47991456 GGAGGAGAGGAGAAGGAGAAGGG - Intronic
1167440679 19:49507024-49507046 AAGGGGGAGGGGAAGGAGAAGGG - Intronic
1167485884 19:49762815-49762837 TGGGGAGGGAAGAAGGAGAAGGG - Intronic
1167488962 19:49780995-49781017 CAGGGACAGGAGAAGCAGAGAGG + Intronic
1167627631 19:50603203-50603225 GAGGGAGAGGAGAGGGAGAAGGG - Intergenic
1167783379 19:51615529-51615551 TGGGGTGAGGAGAAGGAGAACGG + Intronic
1168140263 19:54381208-54381230 CAAGAAGACCTGAAGGAGAAGGG - Intergenic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168459261 19:56539611-56539633 AAGGCAGAGCTGAAAGAGAAAGG - Exonic
1202669858 1_KI270709v1_random:40421-40443 ATGGGAGAGGAGAAGGAGAGCGG + Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925148133 2:1594654-1594676 CGCGAAGAGCAGAATGAGAAGGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925198639 2:1948372-1948394 CAGGAACTGCAGTAGGAGAATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925319975 2:2957467-2957489 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925575152 2:5352502-5352524 CAAGGAACCCAGAAGGAGAAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926073362 2:9919738-9919760 CAGGGAGTCCTGAAAGAGAAAGG + Exonic
926226195 2:10968527-10968549 CAAGGAGAGAGGGAGGAGAAGGG - Intergenic
926249686 2:11147396-11147418 CAGGGAGTACTGAAGAAGAAAGG + Intergenic
926421017 2:12699410-12699432 AAGGGGGAGAAAAAGGAGAAGGG + Intergenic
926553218 2:14325615-14325637 AAGGGAGGAAAGAAGGAGAAGGG + Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
927416651 2:22887235-22887257 CAGGCATATAAGAAGGAGAAGGG - Intergenic
928121900 2:28589898-28589920 CAGGGAGGGATGAAGGAGATGGG - Intronic
928151822 2:28837821-28837843 CAGGGAGAGGAGAAGCTGACTGG + Intronic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928414246 2:31078601-31078623 CAGGCACAGCACAAGGTGAATGG - Intronic
928426622 2:31183827-31183849 GAGGGAGGGAAGAAGGAGAGAGG - Intronic
928854169 2:35784320-35784342 CAAGTAAAGCAGAAGTAGAATGG - Intergenic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929067111 2:37988954-37988976 CAGGAAGGGTTGAAGGAGAAGGG + Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929279869 2:40066074-40066096 GAGGGAGAAGAGAGGGAGAAGGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929744774 2:44645393-44645415 GAGGGTGAGCCCAAGGAGAAGGG + Intronic
929792385 2:45033125-45033147 GAGGGAGGTGAGAAGGAGAAGGG - Intergenic
929812491 2:45202262-45202284 CAGGGAGAAGAGATGGACAAAGG + Intergenic
929822458 2:45284317-45284339 CAGGGAGGGCAGGAGGGGAAGGG - Intergenic
929878991 2:45820447-45820469 AAGGAAGGGCAGAATGAGAAAGG + Intronic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
930686555 2:54314114-54314136 GAGAGAGAGTAGAAGGAGATGGG - Intergenic
930886518 2:56332691-56332713 CAGGGAGAGAAGAGGGAGAGAGG - Intronic
931144126 2:59498072-59498094 GAGGAAGAGGAGAAGGAGAAAGG - Intergenic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931530265 2:63206366-63206388 CTGGGAGAGAAAAAGGATAAAGG - Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932413797 2:71561964-71561986 GCAGGAGAGCAGAAGAAGAAAGG - Intronic
932581272 2:72994100-72994122 CAGGGGGTGCAGCAGGAAAAAGG + Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933091220 2:78119845-78119867 GAGGGAGAGAATAAGGAGGAAGG + Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933263485 2:80155628-80155650 CAGGGAGAGCTGAGGCAGATTGG + Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933633310 2:84680679-84680701 CAGGGAGACCAGAATGGAAATGG + Intronic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
934019854 2:87936710-87936732 CTGAGAGAGAAGCAGGAGAATGG + Intergenic
934298162 2:91759743-91759765 CAGGGAGAGCAAAAGAAGAGAGG - Intergenic
934512486 2:94956967-94956989 CAGGGGGAGCAGAAGGAAATGGG - Intergenic
934648784 2:96075351-96075373 GAAGGAGAGGAGAATGAGAATGG - Intergenic
934784668 2:96996267-96996289 GAGGAAGAGAAGGAGGAGAAGGG - Intronic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
935263068 2:101371409-101371431 CAGGGAGAGCAGAGGCCAAAGGG + Intronic
935591052 2:104845467-104845489 CAGGGAGCGGTGAAGGAGACTGG - Intergenic
935622799 2:105144034-105144056 GAGGGAGAGGAGGAGGAGGACGG - Intergenic
936076469 2:109404705-109404727 CAATGAGAGAAGAATGAGAATGG - Intronic
936118626 2:109722610-109722632 AAGGGAGAGCATCAGAAGAATGG - Intergenic
936266960 2:111018212-111018234 CAGGGAGAGGGGACGGAGGAGGG + Intronic
936600334 2:113889525-113889547 CAGGGTGAGCAGTCGGGGAACGG - Intergenic
936926541 2:117742713-117742735 CAGGAAGAGGAGGAGGAGCAAGG + Intergenic
937052255 2:118902021-118902043 AAGGAAGAGAAGAAGGAAAAAGG - Intergenic
937139354 2:119586043-119586065 CAGGGAGACCAGAAGCTAAAAGG + Intronic
937227251 2:120377064-120377086 CAGAGAGAACAGAAGAGGAAAGG - Intergenic
937330189 2:121021749-121021771 CAGGGAGAGCCAGGGGAGAAGGG + Intergenic
937686812 2:124706847-124706869 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
937688911 2:124731541-124731563 TGGGGAGAGGAGGAGGAGAAAGG + Intronic
937768812 2:125694930-125694952 CAGGGAGAGAAGAAGGAGTGAGG + Intergenic
937872187 2:126793830-126793852 GAGGAAGAGAAGAGGGAGAAAGG + Intergenic
937905338 2:127050235-127050257 AAGGGAGAGGAGAGGGAGAGAGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938120089 2:128627001-128627023 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938386222 2:130869200-130869222 CAGAGAGAGTAGGAGGAGTAAGG + Intronic
938571597 2:132566807-132566829 GAGGGAAAGCTGAGGGAGAATGG - Intronic
938905696 2:135833900-135833922 CATGGAGAGAGGAAGGAGAATGG - Intronic
938925607 2:136038803-136038825 CAGAGAAAGCAGAAAGGGAAGGG - Intergenic
939106623 2:137956019-137956041 CAGCGAGCACAGGAGGAGAAAGG + Intergenic
939603882 2:144228556-144228578 AAAGGAGAAAAGAAGGAGAATGG + Intronic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
940011641 2:149060796-149060818 CAGGGAGAGGTGAAGGATCAGGG + Intronic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
941013370 2:160326563-160326585 CAGAGAGAACAGAATGAGACTGG + Intronic
941038220 2:160590576-160590598 GAGGGAGAGGAGAAGGGGAAGGG - Intergenic
941038230 2:160590600-160590622 AAGGGGGAGGAGAAGGGGAAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941203625 2:162544846-162544868 AAGGGAGGGTAGAAGGAAAACGG - Intronic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
941510605 2:166403898-166403920 GATGGAGAGCAGGAGAAGAAAGG + Exonic
941600399 2:167536562-167536584 AATGGAGAGCAGGAAGAGAAGGG - Intergenic
941770529 2:169340563-169340585 GTGGGATTGCAGAAGGAGAAAGG - Intronic
942043946 2:172088267-172088289 CGGGGAGACAAGAAGGAGACGGG - Exonic
942044028 2:172088639-172088661 CAGACAGAGCAAAAGGAGACAGG - Exonic
942071938 2:172324178-172324200 CAGGGAGAAGAGAAAGAAAAGGG + Intergenic
942623447 2:177873672-177873694 CAGGGACAGGAGATGGAGAGAGG - Intronic
942646169 2:178112902-178112924 CCGGCAGAGCAGCAGGTGAAGGG - Intronic
942792631 2:179778208-179778230 CATGCAGGGCAGATGGAGAATGG - Intronic
943174295 2:184449962-184449984 CAGGTAGAGCAGATGGTGACTGG - Intergenic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944098751 2:195998469-195998491 AAGGCTGAGCAGCAGGAGAATGG + Intronic
944300432 2:198118377-198118399 GAGGGAGAGGAGAGAGAGAAAGG + Intronic
944859493 2:203801139-203801161 CAAGGACAGGAGAAAGAGAAGGG + Intergenic
945167275 2:206959377-206959399 CAGGGATGGCAGGAGGTGAATGG + Intronic
946068073 2:217007218-217007240 CAGGGAGAGAAGAAAGACAAAGG + Intergenic
946085030 2:217162260-217162282 GAGGGAGAGAAAAAGGAGAAGGG - Intergenic
946142674 2:217704964-217704986 CATGGAGAGCCACAGGAGAAGGG - Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946193886 2:218022014-218022036 CCGGGAGGGCAGAGGGTGAAGGG + Intergenic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947159077 2:227193842-227193864 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947159094 2:227193909-227193931 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947159112 2:227193986-227194008 GAAGGAGAGGAGAAAGAGAAGGG + Intronic
947159124 2:227194047-227194069 GAAGGAGAGGAGAAGGAGAAGGG + Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947745701 2:232506338-232506360 CAGGGAGAGAAGAAGCAGAAAGG + Intergenic
947777152 2:232722287-232722309 CAGTCATGGCAGAAGGAGAAGGG + Intronic
947823484 2:233088777-233088799 CAGGCACAGGGGAAGGAGAAAGG + Intronic
948025089 2:234770393-234770415 CATGGAGAGCGCAGGGAGAAAGG - Intergenic
948061504 2:235045921-235045943 CAGGGAGATGGGAAGGAAAAAGG + Intronic
948228165 2:236329106-236329128 CAGAGAGAGCAGTCTGAGAAGGG - Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948574907 2:238943732-238943754 CAGGGAGGGCGGAGGGAGAGGGG - Intergenic
948583224 2:239002450-239002472 CAGGGAGAGAAGGAGGAGTGTGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948845870 2:240682595-240682617 CAGGAAGAGCAGGAAGAGCAGGG + Exonic
948847989 2:240692135-240692157 CAGGAAGAGCAGGAAGAGCAGGG - Exonic
948871936 2:240805072-240805094 CAGGGAGAGGGGAGGGAGAGGGG + Intronic
948963715 2:241359645-241359667 CAGAGAGAGCAGAAAGAAAGAGG - Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169655248 20:7915371-7915393 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1169976876 20:11339040-11339062 GAGAGAGAGAAGAAAGAGAAAGG + Intergenic
1170306349 20:14942419-14942441 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1170418748 20:16171421-16171443 GAGGGAAAGCAGAAAGAGAAAGG + Intergenic
1170802374 20:19601170-19601192 CAGGTAGAGGAGAAGGCGAATGG - Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1170986447 20:21263702-21263724 GAGGAAGAGGAGGAGGAGAAAGG + Intergenic
1171170286 20:23010105-23010127 CAGGGAGAGTAAAGGGAGAAAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172043023 20:32059349-32059371 GAGGAAGAGGAGGAGGAGAAGGG - Intronic
1172180432 20:33000236-33000258 CAGGGAGAGAAGAAGGGATAGGG - Intronic
1172835437 20:37870216-37870238 CAGTGAGACCAGGAAGAGAAAGG - Intronic
1172948559 20:38706891-38706913 CAGGGAAAGGTGAGGGAGAAGGG - Intergenic
1172953013 20:38734104-38734126 GAGGAAGAGAAGGAGGAGAAAGG - Intergenic
1172985877 20:38988817-38988839 CAGGGAGAGTAGCTGAAGAAAGG + Exonic
1172986965 20:38999336-38999358 AAGGAAGAGCAGACAGAGAAGGG - Intronic
1173073242 20:39790499-39790521 CAGGAAGAACAGAGGAAGAAGGG + Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173130740 20:40390888-40390910 CTGGGAGGGCAGAAGGAAAGTGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173407223 20:42777166-42777188 CAGGGAGTGCTGCTGGAGAAGGG - Intronic
1173443137 20:43095672-43095694 CAGGGAGAGGGCAGGGAGAAGGG - Intronic
1173593070 20:44240484-44240506 AAGGGAGGGCAGAAAGAGATGGG + Intergenic
1173596010 20:44258710-44258732 GAGGGAGAGAAGGAGGAGGAAGG - Intronic
1173915882 20:46708775-46708797 CAGGGAGAGAGGAGGGAGATGGG - Intergenic
1174308727 20:49633877-49633899 AGGGGAGAGGAGAATGAGAAGGG + Exonic
1174449095 20:50608981-50609003 CAGGGAGAGTGGAAGGCGGAGGG - Intronic
1174476622 20:50800365-50800387 GAGGGGGAGCAGCAGGAGATGGG + Intronic
1174588222 20:51625107-51625129 CAGGGAGATCACAGGGGGAAAGG - Intronic
1174751125 20:53112201-53112223 CAGGGAGAGCAGAACCACACAGG + Intronic
1174861704 20:54097518-54097540 AAGAGAGAGGAGAATGAGAAAGG - Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1175120265 20:56711128-56711150 GAGGGAGGGGAGGAGGAGAAGGG - Intergenic
1175122531 20:56727193-56727215 CAAGAAGAGCATAAGGAGACAGG - Intergenic
1175389395 20:58616839-58616861 AGGGGAGGGCAGAAGCAGAATGG - Intergenic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1177177129 21:17712305-17712327 AAGGAAGAGGAGGAGGAGAAGGG - Intergenic
1177249368 21:18572253-18572275 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1177299256 21:19219568-19219590 AAGAGAAAGCAGAAGGGGAAGGG + Intergenic
1177327094 21:19605100-19605122 CAGGGAAAGCAGAGGAAAAAGGG + Intergenic
1177740968 21:25153619-25153641 CAAGGATGGCAGAAGGTGAAAGG - Intergenic
1178068030 21:28928113-28928135 TAGGGAAAGAAGGAGGAGAATGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178759286 21:35385270-35385292 CAAGGAGAGCAGAAGGAGAGAGG + Intronic
1178784732 21:35643051-35643073 TAGGGAGAGAAAAAGGAGACAGG - Intronic
1178785404 21:35648842-35648864 AAGTGAGATCAGAGGGAGAATGG - Intronic
1178909678 21:36664398-36664420 GAGGGGGTGCAGAAGGAAAAGGG + Intergenic
1179179817 21:39035784-39035806 GAGTGAGAGCAAGAGGAGAATGG - Intergenic
1179317068 21:40253452-40253474 CAGGTACTGCAGAAGTAGAAAGG - Intronic
1179422646 21:41248912-41248934 CAGGGAGAGTCCAAGGAGGAGGG - Intronic
1179778878 21:43686872-43686894 CAAGGAAAGCATAAGAAGAAAGG + Exonic
1179804296 21:43827094-43827116 CAGGGCGAGCAGAAGCAGCTGGG + Intergenic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180703342 22:17793740-17793762 CAGCAAGGGCAGAAGGAGAGAGG + Intronic
1181470251 22:23134359-23134381 AAGGGAGACCAGAAGAACAAGGG - Intronic
1181495032 22:23282920-23282942 CAGGCAGCGCAGAAAGAGAGGGG - Intronic
1181654843 22:24288074-24288096 CTGGCAGAGCTGAAAGAGAAGGG - Intronic
1181708997 22:24668759-24668781 CTGGCAGAGCTGAAAGAGAAGGG - Intergenic
1181735713 22:24879918-24879940 CAGAAAGAGCAGAAAGAGTAAGG + Intronic
1181762423 22:25067472-25067494 GAGGGAGAGGAGAGGGAGATGGG - Intronic
1181775971 22:25160526-25160548 GAGGGAGAGCAGAAGAGGAGAGG - Intronic
1181907336 22:26209769-26209791 GAGGGAGGGAAGAAGGAGGAAGG + Intronic
1181969310 22:26678182-26678204 GAGGGAGAGGAGGAAGAGAAAGG - Intergenic
1182046229 22:27276255-27276277 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1182550934 22:31100426-31100448 GAGGGAAACCAGAAAGAGAAGGG - Intronic
1182574576 22:31264298-31264320 GAGGCAGAGCAAAAGGACAAGGG + Intronic
1182624538 22:31636157-31636179 CAGGGAGAGAAGGAGGACACAGG + Intronic
1182754561 22:32668382-32668404 CAGGAAGAGGGGAAAGAGAAGGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183035537 22:35138387-35138409 CAGGGAGAGGAGAATGTGAGGGG + Intergenic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183302851 22:37066784-37066806 GAGGGAGAGAGGAGGGAGAAAGG - Intronic
1183333792 22:37235348-37235370 AAGGGAGAGAGGAAGGAGAGTGG - Intronic
1183380288 22:37487272-37487294 CAGGGTGAGTAGCAGGAGATGGG - Intergenic
1183703749 22:39464330-39464352 CAGGGAGAGCTGCAGGTGACTGG + Intronic
1183715377 22:39530172-39530194 CAGTGAGAGATGAAGGACAAAGG + Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184160335 22:42693803-42693825 GTGGGAGAGCCCAAGGAGAAAGG - Exonic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184449758 22:44575957-44575979 GAGGAAGAGAAGGAGGAGAAGGG + Intergenic
1184462698 22:44648384-44648406 GAGGGAGAGAAGGAGGAGACAGG + Intergenic
1184600212 22:45539056-45539078 GAGGAGGAGGAGAAGGAGAAAGG - Intronic
1184792474 22:46708591-46708613 TAAGGAGAGGAGATGGAGAAAGG + Intronic
1184889962 22:47373624-47373646 AAGGGAGGCCAGGAGGAGAAGGG + Intergenic
1184889968 22:47373642-47373664 AAGGGAGGCCAGGAGGAGAAGGG + Intergenic
1184970937 22:48019400-48019422 GGGGCAGGGCAGAAGGAGAAAGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185071593 22:48659597-48659619 CAGGGAGAAAAGCAGGACAAGGG - Intronic
1185106949 22:48877194-48877216 GAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1185135784 22:49071358-49071380 GAAGGAGAGAAGAGGGAGAAAGG - Intergenic
1185168861 22:49279739-49279761 CATGGAGAGCAGAAGGCAATGGG - Intergenic
1203324981 22_KI270738v1_random:4868-4890 ATGGGAGAGAAGAAGGAGAGTGG - Intergenic
949113780 3:295032-295054 AAGGAAGAGGAGAAGGAGAAAGG - Intronic
949456947 3:4249006-4249028 CAGTGAGAAGTGAAGGAGAAGGG - Intronic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
949729933 3:7097152-7097174 CAGGTAAAGCAGATGGAGAGTGG + Intronic
950358665 3:12434413-12434435 GAGGGAGGGGAGAAGGAAAAGGG - Intergenic
950401586 3:12773204-12773226 GAGGGAGAGAGGAAGGAGGAAGG + Intergenic
950555436 3:13692986-13693008 GAGGGAGAGGGCAAGGAGAAAGG - Intergenic
950573474 3:13816534-13816556 CAAGGAGGTCAGAAGCAGAAGGG + Exonic
950840393 3:15963255-15963277 CTGGGAGAGAGGAAGCAGAAAGG + Intergenic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950842093 3:15977559-15977581 CAGGGAGGATAAAAGGAGAAAGG + Intergenic
950932928 3:16809114-16809136 TAGGGAAAGGAGTAGGAGAAGGG + Intronic
950962399 3:17119803-17119825 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951274312 3:20666461-20666483 CAGGGTGAGTAGAAGGTGAGAGG + Intergenic
951457328 3:22907243-22907265 AGGGGACAGCAGCAGGAGAATGG + Intergenic
951485418 3:23203694-23203716 CAGGGAGAGAAGAGGCAGAAGGG - Intronic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952201188 3:31129584-31129606 GAGGGAGAGAAACAGGAGAATGG + Intergenic
952470349 3:33642912-33642934 GAGGAAGAGAAAAAGGAGAAAGG + Intronic
952752527 3:36836854-36836876 CAGCAAGAGCTGAAGCAGAAAGG - Intronic
952829947 3:37556288-37556310 AGGGTAGAGCAGAAGGAAAAAGG - Intronic
953428821 3:42819850-42819872 AAGGAAGTGCAGGAGGAGAAAGG - Intronic
953569416 3:44059231-44059253 CAGTGAGATTGGAAGGAGAAGGG + Intergenic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
954135650 3:48580981-48581003 CAGGGAGAGGGGACAGAGAAGGG + Intronic
954271173 3:49510584-49510606 CACAGAGAGCAGGAGGAGAAAGG - Exonic
954405750 3:50344162-50344184 GAGGGAGGGCATGAGGAGAAGGG - Intronic
954510577 3:51121287-51121309 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
954573545 3:51662365-51662387 CAGGGAGAGAAGAAGGGTAGAGG - Intronic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
954652336 3:52172683-52172705 CAAGGAGAGGAGAAGGAGCTGGG + Intergenic
955059120 3:55481656-55481678 TAGGGAGGGGAGAAGGAGATGGG + Intronic
955117220 3:56017664-56017686 CAGGGAGTGCTGGAGTAGAATGG - Intronic
955484656 3:59423490-59423512 CAGTGACAGCTGAAGCAGAAAGG + Intergenic
956100011 3:65758281-65758303 CGGGGAAAGGAGAAAGAGAAAGG + Intronic
956252282 3:67247137-67247159 CACAGAGAGCAGACAGAGAAAGG - Intergenic
956316873 3:67947957-67947979 GAGGGTGAGCTGAAGGAGAGCGG + Intergenic
956601176 3:71024244-71024266 CAGTGACAGTTGAAGGAGAAAGG - Intronic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
956764721 3:72474790-72474812 CAGGGAGATCAAAAGCAGATAGG + Intergenic
956846031 3:73183709-73183731 CAGAGAGGGAAGGAGGAGAAGGG - Intergenic
957174336 3:76786417-76786439 CAGTGATGGCAGAAGGTGAAGGG + Intronic
957437876 3:80202057-80202079 CAGTGAGGGGAAAAGGAGAAAGG + Intergenic
957479235 3:80770132-80770154 TGGGGAGATCAGAAGGGGAATGG + Intergenic
957640746 3:82850210-82850232 AAGGGAAAGGGGAAGGAGAAGGG - Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958685535 3:97387904-97387926 CAGTCATAGCAGAAGGTGAAGGG + Intronic
958744476 3:98115780-98115802 CAAGGAGAAAAAAAGGAGAAAGG - Intergenic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959296731 3:104544835-104544857 CAGGAAGAACAAAATGAGAAAGG - Intergenic
959366562 3:105466977-105466999 CAGGTAGAAGAGAAAGAGAAGGG + Intronic
959432480 3:106271613-106271635 AAGGGAGAGAAGAGGAAGAAAGG + Intergenic
959531531 3:107439540-107439562 TGGGGAGAGGAGAAGGAGATGGG + Intergenic
960051254 3:113241414-113241436 CCGGGAGAGCAGAGGGGGAGAGG - Intronic
960714215 3:120559765-120559787 GAGGGAGAAGAGAGGGAGAAAGG - Intergenic
960734546 3:120764170-120764192 CAGGGAAGGAAGAAGGTGAAGGG - Intronic
960942585 3:122944286-122944308 AAGGGAGAACAGAAGCACAAAGG - Intronic
961207775 3:125100195-125100217 CAGGGACAGGAGAAAAAGAAAGG + Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961552051 3:127674999-127675021 CAGGGAGAGCCGAAGGAATGAGG - Intronic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
961985216 3:131124574-131124596 AAGGGAGAAGAGGAGGAGAATGG + Intronic
962317758 3:134369382-134369404 GAGGGAGAGGACGAGGAGAAAGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962862249 3:139414830-139414852 CAGGGTGAGCAGATGGGGAGGGG - Intergenic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
963108940 3:141669398-141669420 GAAGGAGAGGAGAATGAGAATGG + Intergenic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963930720 3:151001674-151001696 GAGGGAGAGCATATGGAGATGGG - Intergenic
963978254 3:151507151-151507173 CAGGGAAAGCAGAGGAATAAAGG - Intergenic
964374389 3:156035371-156035393 GAGGGAGAGGAGGAGGAAAAAGG - Intergenic
964654792 3:159054474-159054496 CAGGGAGAGAGGGAGGGGAATGG - Intronic
964777343 3:160292756-160292778 CAGGGAGAGGGGGAGGAGAAAGG + Intronic
964870080 3:161303866-161303888 CCGGGAGAGAAGAAGGAATAGGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
965990871 3:174816219-174816241 AAGGCAGAGGAGGAGGAGAAGGG - Intronic
966020209 3:175200539-175200561 CAGGAAGTGGAAAAGGAGAAAGG - Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966570362 3:181435189-181435211 CAGGGAGAGAAGAAGTAGTTTGG - Intergenic
966673081 3:182551469-182551491 GAGGGAGAGCATAACGATAAAGG - Intergenic
966923541 3:184629875-184629897 CAGGGGGAGGAGGAGGTGAAAGG + Intronic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
966947304 3:184785838-184785860 CAGGGATCGCAGAAAGAAAAAGG + Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967089194 3:186120802-186120824 CATGGAGATCATAAGAAGAACGG + Intronic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968071894 3:195789315-195789337 CAGGGGGCCCAGAAGGACAATGG - Exonic
968073277 3:195801507-195801529 CAGGCAGGAGAGAAGGAGAAAGG - Intronic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
968858986 4:3151398-3151420 GAGGGAGAGAGGAGGGAGAAAGG + Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968957373 4:3726178-3726200 GAGGGAGAGGAGAGAGAGAAAGG + Intergenic
968971187 4:3796073-3796095 AAAGGTGGGCAGAAGGAGAAGGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969450215 4:7268719-7268741 CAGGGAGTGGAGGAGGAGCAGGG + Intronic
969511576 4:7620944-7620966 CAGGGGTCGCAGCAGGAGAAGGG - Intronic
969573364 4:8022990-8023012 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
969591246 4:8123029-8123051 CAGGAAGAGCAGCAGCAGATAGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969828718 4:9778736-9778758 CAGATAGAGCAGAGGGAGAAAGG + Intronic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
969899415 4:10335099-10335121 CAGCGAGAACACTAGGAGAAAGG - Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
970858571 4:20676159-20676181 GAGGGAGAGAAGAAGGAGAGAGG + Intergenic
970969974 4:21970946-21970968 GATGGAGAACAGAAGTAGAAAGG + Intergenic
972227579 4:37031439-37031461 CAGGGATAATAAAAGGAGAAAGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972328339 4:38039595-38039617 CAAGCAGCTCAGAAGGAGAATGG - Intronic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
972700954 4:41492421-41492443 GAGGGAGCCCAGAGGGAGAAGGG + Intronic
972768240 4:42171512-42171534 CACAGAGAGAAGAAAGAGAAGGG - Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973723705 4:53751100-53751122 CTGGGAGGGAAGAAGGAAAAGGG - Intronic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
974359980 4:60865053-60865075 CAGGGAAAGGACAAGAAGAAGGG - Intergenic
974896510 4:67946499-67946521 CAGGGACAACACAATGAGAACGG + Exonic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
976217503 4:82729015-82729037 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
976248364 4:83025932-83025954 AAGTGAGAGCAGATAGAGAAGGG - Intergenic
976571475 4:86616716-86616738 CAGGAAGCTTAGAAGGAGAAGGG - Intronic
976598650 4:86917565-86917587 GAGGGAGGGAGGAAGGAGAAGGG + Intronic
976607910 4:86999831-86999853 CAGTGATGGCAGAAGGAGACTGG + Intronic
976777179 4:88719570-88719592 GAGGAGGAGAAGAAGGAGAAAGG - Intergenic
976961449 4:90981016-90981038 CAGGTAGACCTGAAGTAGAAGGG + Intronic
977156784 4:93583760-93583782 AAGTGAGAACTGAAGGAGAATGG - Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
977796508 4:101172069-101172091 GATGGAGAGCAGTGGGAGAAAGG + Intronic
978441102 4:108734417-108734439 AAAGGAGAGAAAAAGGAGAAAGG + Intergenic
978621385 4:110637279-110637301 CCGGGAGAGCGAAAGGAGAGGGG + Intronic
979147789 4:117267196-117267218 CAGCGAGTCCAGAAAGAGAAGGG + Intergenic
979710604 4:123774444-123774466 GAGGGAGAGGAGGATGAGAAAGG - Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
980875415 4:138657497-138657519 GAGAGAGGGCAGAAGGAGCAGGG - Intergenic
980981424 4:139657576-139657598 GAGGAAGAGGAGGAGGAGAAGGG + Intergenic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981470867 4:145132873-145132895 AAGGGAGAAAGGAAGGAGAAAGG - Intronic
982410989 4:155077126-155077148 CTGAGAGAGAAGAAGGGGAAAGG + Intergenic
982456253 4:155612321-155612343 CAGCTAGAGCAGCAGGAGCAAGG - Intergenic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
982837094 4:160132358-160132380 TAGGGAGAAAAGATGGAGAAAGG + Intergenic
983203149 4:164884012-164884034 GAGGAAGAGAAGAAAGAGAAGGG + Intronic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
984050994 4:174865113-174865135 CATGGAGAACACAAGGAGAAAGG + Intronic
984103318 4:175513977-175513999 CAGTCACAGCAGAAGGTGAAGGG - Intergenic
984171326 4:176362744-176362766 TAGAGAGGGGAGAAGGAGAAGGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985190662 4:187369322-187369344 CAGGGAGAGGGTAAGGAAAAGGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985884197 5:2663776-2663798 CAGGGAGAGAGGCAGCAGAAAGG - Intergenic
985937195 5:3106425-3106447 GAGGGAGAGCAGAGGGAGAGGGG - Intergenic
986047583 5:4054479-4054501 GAGGAAGAGGAGAAGGACAAGGG - Intergenic
986183625 5:5416971-5416993 GAGGGAGAGGGGAAGGAGGACGG + Intergenic
986348903 5:6858933-6858955 GGTGGAGAGAAGAAGGAGAAGGG - Intergenic
986542284 5:8858176-8858198 CAAGGAGAGCCTAAGGAGACAGG + Intergenic
986558977 5:9041634-9041656 CAGGGAGAGGTGAGGGTGAATGG + Exonic
986618292 5:9643009-9643031 AAGGGAGGGAAGAAGGAAAAAGG - Intronic
986623180 5:9697066-9697088 GAGGACGAGGAGAAGGAGAAAGG + Intronic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
987186776 5:15429512-15429534 GAGGGAGAGGAGAAAGTGAAAGG - Intergenic
987266027 5:16255908-16255930 GAGAGAGAGCAAAGGGAGAAGGG + Intergenic
987266985 5:16266081-16266103 GAGGGAGAGCAGATGGAGAGGGG - Intergenic
988042844 5:25910939-25910961 CAGGATGAGCAGGATGAGAATGG + Intergenic
988555013 5:32229049-32229071 CAGGGAGTGCAGAGGGACAGCGG + Exonic
989093927 5:37763556-37763578 CAGGAAAAGCAGAGGAAGAAGGG + Intergenic
989200764 5:38760601-38760623 GAGGGAGAGAGGAAGGAAAATGG + Intergenic
989351776 5:40494908-40494930 GAGGGACAGCAGAAGGATATGGG + Intergenic
989459445 5:41680570-41680592 CAGGAAGAGGAGAAAAAGAAGGG + Intergenic
989788325 5:45358959-45358981 GAGTTAGAGCAGAAGAAGAAAGG - Intronic
989798915 5:45511123-45511145 CATGGAGAGCTCATGGAGAATGG - Intronic
989975156 5:50576863-50576885 CAGGGAGGACAGATGGATAAAGG + Intergenic
990017143 5:51077586-51077608 CAAGCATGGCAGAAGGAGAATGG + Intergenic
990091463 5:52056211-52056233 CTGAGATATCAGAAGGAGAAAGG + Intronic
990232681 5:53731167-53731189 CAATGATAGCAGAAGGTGAAGGG - Intergenic
990352712 5:54934851-54934873 CTGGGAGATCAGAAGGTGACAGG + Intergenic
990893932 5:60676744-60676766 GATGGGGAGGAGAAGGAGAAGGG - Intronic
991272177 5:64796911-64796933 CAGGGAGAGAAAGAGAAGAAAGG - Intronic
991298110 5:65102750-65102772 CCGGGAGAGACGAGGGAGAAAGG - Intergenic
991513803 5:67411357-67411379 CAAGGATAGCGGAAGGAAAAAGG + Intergenic
991544344 5:67765015-67765037 GTGGGTGAGCAAAAGGAGAAAGG + Intergenic
991639676 5:68739843-68739865 CAGGGAGGGCTGAGTGAGAAGGG - Intergenic
991720721 5:69492747-69492769 GAGGGAAAGGAGAGGGAGAAGGG + Intronic
993043322 5:82839718-82839740 CAGGGAGAGCAGGAGGGAAGTGG + Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993505106 5:88699712-88699734 CAGGAAGAGGATGAGGAGAAAGG - Intergenic
993514852 5:88818740-88818762 CAGGTAGAGCAGGAGCACAAAGG - Intronic
993534871 5:89070883-89070905 CAGGGGGTGGAGTAGGAGAAGGG - Intergenic
993861801 5:93145380-93145402 AAGGGAGAGCAGAGGCAGACTGG - Intergenic
994030510 5:95136456-95136478 GAGGGAGAGGAGAAGGAAGATGG + Intronic
994168783 5:96636888-96636910 CGTGGGGAGCAGAAGGATAAGGG + Intronic
994207376 5:97050561-97050583 GAGGAAGAGAAGAAAGAGAATGG + Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
994744266 5:103659232-103659254 CAGGGAGAGCAGCAACAGGAAGG + Intergenic
994784836 5:104144832-104144854 AAGGAAGAGGAGGAGGAGAAAGG - Intergenic
995062287 5:107823781-107823803 CAATCACAGCAGAAGGAGAAGGG - Intergenic
995082175 5:108065027-108065049 TAGGGATAGAAGAGGGAGAAAGG - Intronic
995274203 5:110259629-110259651 CAGGGAGAGCAGATTTAGGATGG + Intergenic
995331270 5:110949658-110949680 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
995885328 5:116888152-116888174 AAGGGAGAGCAGCAGGAGGGTGG + Intergenic
996313740 5:122137694-122137716 AAGGGAGAGCAAAAGGAGATAGG + Intronic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996700223 5:126443582-126443604 TGGGGAGAGCAGAAGGTGACTGG - Intronic
996792872 5:127312093-127312115 CAGTGAGAGAGGAAGGAGCAAGG - Intronic
996883331 5:128326292-128326314 GAGGGAGAGAAGATTGAGAATGG + Intronic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997123824 5:131205150-131205172 GAGAGAGAGGAGAAAGAGAAGGG - Exonic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
997633839 5:135390122-135390144 CAGGGAGAAAAGAAGTGGAAGGG - Intronic
997981123 5:138467860-138467882 CCGGGAGAGGAGAAGGAGGTGGG - Exonic
998155404 5:139783923-139783945 AAGAGCTAGCAGAAGGAGAAAGG - Intergenic
998350356 5:141496355-141496377 CAGGGAGAGAAGCAGGAGCTTGG + Intronic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998553609 5:143101809-143101831 TAGGGAGAGAAGCTGGAGAAGGG + Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999065213 5:148678445-148678467 GAGGGAGGAAAGAAGGAGAAAGG - Intergenic
999296361 5:150461831-150461853 GAGGGAGAGAGGAAGGAAAAAGG - Intergenic
999435384 5:151559453-151559475 CAGGAAGAGCACAAGGACTAGGG + Intronic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
1000034369 5:157432355-157432377 CAGGGATGGCAGAGGCAGAAAGG - Intronic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000599996 5:163261173-163261195 CAGGAAGAGGTGAAGGAGAAAGG + Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001020522 5:168178631-168178653 CAGGGAGAGGAAAAGAAGGAAGG + Intronic
1001087890 5:168714762-168714784 CAGGGAGAAGGGGAGGAGAAAGG - Intronic
1001171832 5:169426826-169426848 CACTCATAGCAGAAGGAGAAGGG + Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001535342 5:172494156-172494178 CTGGCAGAGAAAAAGGAGAAGGG + Intergenic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002056711 5:176602065-176602087 GAGGGAGAGCAGCAGCAGAAAGG - Intronic
1002715852 5:181226711-181226733 CAGGGGGAGGTGAAAGAGAAAGG - Intronic
1002795674 6:469435-469457 CAGGGAGAGGAGGGGGAGAGAGG - Intergenic
1002853288 6:1015621-1015643 GAGGGAGAGCATTAGGACAAAGG + Intergenic
1002979434 6:2121380-2121402 TAAGGAGAGCATGAGGAGAATGG - Intronic
1003046439 6:2737448-2737470 CAGAGACTGAAGAAGGAGAATGG - Intronic
1003064871 6:2895284-2895306 GAGGGAGAGGAGGAGGAGAGAGG + Intronic
1003664731 6:8100438-8100460 AAGGGAAAGCAAAAAGAGAAGGG + Intronic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1004950706 6:20668076-20668098 CAGGGAGGGAAGAAAGAGAGGGG - Intronic
1004999745 6:21229034-21229056 CAGGGAGACCAGCAGGATATCGG + Intronic
1005301590 6:24476369-24476391 CATGGAGGGAAGGAGGAGAAGGG - Intronic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1005955376 6:30659834-30659856 CCTGGAGAGCAGAAAGAGATGGG + Exonic
1006047508 6:31309427-31309449 GAGTGAGAGAAGAAGGAGAGGGG - Intronic
1006340543 6:33443998-33444020 CAGGGAGGGAAGAAGGAGATGGG + Intronic
1006516058 6:34546363-34546385 CTGGGACAGCAGGAGGGGAAGGG + Intronic
1006562968 6:34929759-34929781 GAGGGGGAGGGGAAGGAGAAGGG - Intronic
1006574289 6:35032698-35032720 AAGGGTGAGGTGAAGGAGAAGGG - Intronic
1006772192 6:36562878-36562900 TAGGTATAGCAGGAGGAGAAAGG + Intergenic
1007178775 6:39913629-39913651 CAGGGAGAGAAGAGGTGGAAGGG + Intronic
1007345228 6:41223943-41223965 CATGGAGAGGAGAAGAGGAAGGG + Intergenic
1007377450 6:41466573-41466595 GAGGGAAAGGAGAAGGAGATAGG + Intergenic
1007714791 6:43849482-43849504 CAGGGAGAGGAGAAGAAGCAGGG + Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007744369 6:44034467-44034489 CAGGGAGAGAGGCAGGGGAAGGG + Intergenic
1007783996 6:44270216-44270238 CACGGAGAACAGATGGAGAGGGG + Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008260856 6:49365581-49365603 CAGTCATAGCAGAAGGTGAAGGG + Intergenic
1008362338 6:50635548-50635570 AAGGGAGGGGAGAAGGGGAAAGG + Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008663099 6:53689421-53689443 AAGGGAGACCAAAAGAAGAATGG - Intergenic
1008800482 6:55362945-55362967 AAAGGAGAGGAGGAGGAGAAGGG + Intronic
1008862981 6:56173376-56173398 AAGGGAAAGGAGAAGGGGAAGGG + Intronic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009957004 6:70467700-70467722 AAAGGAGAAAAGAAGGAGAAAGG - Intronic
1010613961 6:77990619-77990641 AAGAGAGAGGAGAAGGAGAGGGG - Intergenic
1010683512 6:78823912-78823934 CAGGGAGTAGAGAAAGAGAAAGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011699398 6:89941760-89941782 CATTTAGAGCAGAAGCAGAATGG - Intronic
1011720596 6:90152135-90152157 CATGGACAGCAGAGGCAGAAAGG - Intronic
1011919556 6:92555676-92555698 AAGGGAGACCAGAACAAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012326769 6:97929258-97929280 CAGGGAGAGCACAATGAGTCAGG - Intergenic
1012466745 6:99523938-99523960 CATGGAGAGATGAGGGAGAAAGG + Intergenic
1012930488 6:105311149-105311171 CAGAGAGAGCAGATGGACATTGG - Intronic
1013192961 6:107819345-107819367 CAGGGAGAGGAAAAGGGCAAGGG + Intronic
1013210681 6:107983976-107983998 AAGGGGGAGCAGACCGAGAAAGG + Intergenic
1013311240 6:108895834-108895856 GAGGGAGAGGAGGAGGGGAATGG + Intronic
1013654246 6:112228774-112228796 CAGGGAAAGTAATAGGAGAAGGG - Intronic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1014261678 6:119225434-119225456 AAGGAAGAGGAGGAGGAGAAAGG + Intronic
1014444850 6:121515088-121515110 GAGGGAGAGCAGATAGAGTATGG + Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015626163 6:135182293-135182315 GAGGGAGAGGAGGAGGAGGAGGG + Intronic
1015636016 6:135275019-135275041 CAGGCAGAGAAGAAGAAAAAAGG + Intergenic
1015723727 6:136276400-136276422 AAGGGAGGGCAGAGGGAGAATGG - Exonic
1015878453 6:137847106-137847128 AAGGTAGAGCAGAAGCTGAAGGG - Intergenic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016439264 6:144066629-144066651 TAGGGGGAGCAAAAGGAGAGTGG + Intergenic
1016486187 6:144542371-144542393 CAGGGAGAGCCCAGGGTGAAGGG + Intronic
1016546417 6:145229247-145229269 AGGGGAGAGGAGAAGGAAAAGGG - Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016887509 6:148971677-148971699 CAGGGCGAGCTGAGGAAGAAAGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1017359180 6:153545966-153545988 TGGGGAGGGCAGAAGGAGCATGG - Intergenic
1017461568 6:154655884-154655906 CAGGGAGAGCAGAACAAGAGAGG + Intergenic
1017462956 6:154668355-154668377 GAGGGAGAGGAGGAGGAGAAAGG + Intergenic
1017645670 6:156538094-156538116 CAGGCAGAGAGGAAAGAGAAAGG - Intergenic
1018108545 6:160512737-160512759 CAGGGAGAGGAGAATGAAAAGGG - Intergenic
1018212262 6:161493625-161493647 CACGAAGAGCAGATGCAGAAAGG + Intronic
1018739550 6:166717024-166717046 CAGGGAGTGAGGATGGAGAATGG + Intronic
1019218995 6:170460236-170460258 CAGAGAGAGAAAAAGGAGAAAGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019579180 7:1751597-1751619 CAGGGAGCCCAGCAGGAGATGGG - Intergenic
1019856248 7:3611352-3611374 GAGGAAGAGCAGGAGGAGAAAGG - Intronic
1019964098 7:4484777-4484799 GAGGGAGAGGAGGAAGAGAAAGG + Intergenic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020629666 7:10625214-10625236 GAGGGCGAGCAGAAGCAGAGGGG + Intergenic
1020672085 7:11128744-11128766 GAGGGAGAGAGGAGGGAGAATGG - Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021170398 7:17392263-17392285 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1021972223 7:25976649-25976671 CAGGCAGGGCAAAAGGGGAAGGG + Intergenic
1022267707 7:28773683-28773705 CAGGGAAAGCAGAAAGATATGGG - Intronic
1022357049 7:29625780-29625802 GAGGGAAAGGGGAAGGAGAAGGG + Intergenic
1022704243 7:32787860-32787882 CAGGGAGACCAGAGGCAGAGGGG + Intergenic
1022908425 7:34877602-34877624 CAGGGAGACCAGAGGCAGAGGGG + Intronic
1023085774 7:36568743-36568765 TAAGGAGAGAAGAAAGAGAAGGG - Intronic
1023569504 7:41557400-41557422 CATGTAGACTAGAAGGAGAAAGG + Intergenic
1023587294 7:41743956-41743978 CAGGGAGAGAAAAGGGTGAAAGG - Intergenic
1023611322 7:41974093-41974115 TATGGAGACCAGAAGGAGAGAGG + Intronic
1023687575 7:42752342-42752364 CATGGGGAGCAGATGGCGAAGGG - Intergenic
1023730226 7:43184837-43184859 CAGTGATAGCGGAAGGTGAAGGG + Intronic
1024099068 7:46010704-46010726 CTGGGAGGGCAGCAAGAGAAAGG - Intergenic
1024109783 7:46133618-46133640 GAGGGAGAGAAGGAGGAGGAGGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024461292 7:49662172-49662194 TAAGGAGAGAAGAAAGAGAAGGG - Intergenic
1024620867 7:51156816-51156838 AAGGGGGAGAGGAAGGAGAAGGG - Intronic
1024792116 7:52978345-52978367 CAGGGAGGGAAGAGGAAGAATGG - Intergenic
1024914591 7:54485008-54485030 CTAGGAGAGAACAAGGAGAAAGG - Intergenic
1025247510 7:57328498-57328520 CAGGCAGAGGAGAGAGAGAAAGG - Intergenic
1025320381 7:58088080-58088102 ATGGGAGAGAAGAAGGAGAGCGG + Intergenic
1026114695 7:67486394-67486416 AAGACAGAGCAGAAGGGGAATGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026262836 7:68770633-68770655 CAGAGAGAGAAGAAGGAAATAGG + Intergenic
1026266905 7:68803184-68803206 CAGGGTGAGAACCAGGAGAAAGG + Intergenic
1026319264 7:69254773-69254795 AAGGGAGAGAGGAAGGAGAAAGG + Intergenic
1026324721 7:69299163-69299185 AAGGGAGAGGAGGAAGAGAAGGG + Intergenic
1026394396 7:69936873-69936895 AAGGGAGAGAAAAAGGAGAAAGG - Intronic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1026580749 7:71614690-71614712 GAGGGAGGGAAGAAAGAGAAAGG + Intronic
1026800605 7:73397755-73397777 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026800611 7:73397773-73397795 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1027981207 7:85225319-85225341 GAGAGAGAGAGGAAGGAGAAGGG - Intergenic
1028210577 7:88069240-88069262 GAAGGAAAGCAGAAGGAGAGAGG - Intronic
1028253349 7:88561630-88561652 CAGGGAGGGGAGAAGAAGAGAGG - Intergenic
1028611522 7:92717362-92717384 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028873650 7:95796182-95796204 TAGTGAGGGGAGAAGGAGAATGG + Intronic
1028998447 7:97127095-97127117 GAGGGCGAGCAGAAGCAGCATGG - Intronic
1029094874 7:98077190-98077212 GAGGAGGAGCAGGAGGAGAAGGG + Intergenic
1029304288 7:99607356-99607378 GAGGTAGAGCAGTAGGAAAATGG + Intronic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029478361 7:100798636-100798658 CAGGGAGGGCAGAAGGAACAGGG + Intergenic
1029535304 7:101154424-101154446 GAGGGAGGGCAGCAGGAGAAAGG + Exonic
1029795852 7:102893818-102893840 GAGGGGGAGAAGAAGGGGAAGGG + Intronic
1029956910 7:104649740-104649762 TAGTGAGAGCAGCAGGAGTAGGG + Intronic
1030157418 7:106469103-106469125 CAGGGAGAGAAAGAAGAGAAAGG - Intergenic
1030580322 7:111347120-111347142 CAGAGAGAACAGAGGCAGAAAGG + Intronic
1030656051 7:112169188-112169210 CAGTCACAGCAGAAGGTGAAGGG - Intronic
1030735550 7:113043558-113043580 CAAGGAGAGCACAAGGGGGAAGG + Intergenic
1031529281 7:122856419-122856441 CAAGAAGAGAAGAAAGAGAAGGG - Intronic
1031595105 7:123640717-123640739 GAGGGGGAGGAGAAGGGGAAGGG + Intergenic
1031796204 7:126176992-126177014 GAGGAGGAGGAGAAGGAGAAGGG - Intergenic
1031975441 7:128090654-128090676 AAGGGAGAGCAGTGGGCGAATGG - Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032619115 7:133509521-133509543 CAGGGAGAGAGGAAGAGGAAGGG - Intronic
1032620783 7:133529194-133529216 AAGGCAAAGAAGAAGGAGAAAGG - Intronic
1032660947 7:133983084-133983106 CAGTCATAGCAGAAGGAAAAGGG + Intronic
1032795448 7:135272380-135272402 CAGGGAGAGGGGGAGGAGATGGG + Intergenic
1032906575 7:136374374-136374396 CAAAGAGAGAAGAATGAGAAGGG + Intergenic
1033004659 7:137548552-137548574 CAGTCAGGGCAGAAGGTGAATGG - Intronic
1033038684 7:137898988-137899010 GAGGGAGAAAGGAAGGAGAAGGG + Intronic
1033382596 7:140837897-140837919 AAGTGAGAGTAGAAGAAGAATGG - Intronic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034257488 7:149732665-149732687 TAGGGAGAGTAAAAGCAGAAGGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034427064 7:151019528-151019550 AAGGGAGGGCAGAAAGAGAAAGG - Intronic
1034700933 7:153095128-153095150 CAGTCACGGCAGAAGGAGAAAGG + Intergenic
1034746929 7:153530831-153530853 GAGGGTGAGCTGAAAGAGAATGG - Intergenic
1034852060 7:154502576-154502598 CAGTCACAGCAGAAGGTGAAAGG - Intronic
1035038406 7:155910218-155910240 CAGGCAGAGGAGGAGGAGCAAGG - Intergenic
1035057810 7:156047945-156047967 CACGGACAGCAGGAGGGGAAAGG + Intergenic
1035108016 7:156458223-156458245 CGGGGAGGGCAGAGGAAGAAAGG + Intergenic
1035172314 7:157024154-157024176 CAGGGGGAGCGGGAGGGGAATGG - Intergenic
1035481404 7:159190236-159190258 GAAGGAGAGGAGAAGGAGCAGGG + Intergenic
1035760449 8:2064783-2064805 CCAGGAGAGGAGAAGGAGGAGGG - Intronic
1036037045 8:5031060-5031082 CAGGAAGACCTGAAGGAGAGGGG - Intergenic
1036052084 8:5210075-5210097 CAGGTAGAGCAGGAGCAGAAGGG - Intergenic
1036115756 8:5959187-5959209 CAGGGAGCCCAGAAGCAAAAGGG + Intergenic
1036424226 8:8628487-8628509 CAGGGAGGGCAGAAGGAAAATGG - Intergenic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1037041267 8:14237956-14237978 CTGGGAGAGAAAAAGGAAAAGGG - Intronic
1037599607 8:20382929-20382951 CAGGGAGAGAAACAGGAGACGGG - Intergenic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1037655440 8:20879695-20879717 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1037731010 8:21524088-21524110 CAGAGAGCACAGGAGGAGAATGG - Intergenic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1038411287 8:27361685-27361707 CTGGGATACCAGAAAGAGAAGGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1038927232 8:32154269-32154291 GGGGGAGAGCAAAAGGGGAAGGG - Intronic
1039374938 8:37023861-37023883 CAGGGAGAGCAGAGATAGCAAGG - Intergenic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1039944118 8:42115590-42115612 CAGGGGCAGCGGATGGAGAAGGG - Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1040733067 8:50473287-50473309 CAGTTATAGCAGAAGGTGAAGGG - Intronic
1040781986 8:51120528-51120550 CAGAGAGTGCTGAATGAGAAAGG - Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041089269 8:54287130-54287152 CATGGAGATAGGAAGGAGAATGG - Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041507006 8:58610303-58610325 CAGTTAAAGCAGAATGAGAAGGG - Intronic
1041574015 8:59372272-59372294 TAAGGAGAGCTGAAAGAGAAAGG - Intergenic
1041635219 8:60134983-60135005 CAGGGAGAGCAGCAGGCAAGTGG - Intergenic
1042382297 8:68130962-68130984 TAGGCAGAGGAGAAGGACAAGGG + Intronic
1043065877 8:75569252-75569274 CAGGAAGACTAGAAGGGGAAAGG - Intergenic
1043260496 8:78188515-78188537 AGGGGAGGGGAGAAGGAGAAGGG + Intergenic
1043472147 8:80573645-80573667 GAAGGTGAGTAGAAGGAGAATGG - Intergenic
1043817732 8:84823730-84823752 CAAGGAGAGAATGAGGAGAAAGG - Intronic
1043978957 8:86615844-86615866 TAGGGAGGGAGGAAGGAGAATGG + Intronic
1044096904 8:88078099-88078121 GAGGGAGAGGAGAAAGAGACAGG - Intronic
1044289109 8:90446941-90446963 GAGGGAGAGGAGAAGGAAAGAGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044503109 8:92985276-92985298 CAGAGAGAGAAGAAGAAGAGAGG + Intronic
1044627852 8:94251811-94251833 CAGGTAGACCAGATGGACAAGGG + Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1044952118 8:97445039-97445061 AAGGGAAAGCAAAAAGAGAAAGG - Intergenic
1044983270 8:97736430-97736452 GAGGGGGAGGAGAAGGAGAAAGG + Intergenic
1045015058 8:97994212-97994234 AAGGGAAAGAGGAAGGAGAAGGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045274280 8:100688319-100688341 AAGGGAGAGAGGAAAGAGAAGGG + Intronic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1046186610 8:110729735-110729757 AAGGGAGAAAAGAAGGAAAATGG + Intergenic
1046300289 8:112277739-112277761 CAATTATAGCAGAAGGAGAAAGG + Intronic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1046450558 8:114384938-114384960 CAAGGACAGAAGAATGAGAAAGG + Intergenic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1046893849 8:119451559-119451581 TAGGTAGAGCAGTAGGAGATGGG - Intergenic
1046947555 8:119988306-119988328 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
1047174601 8:122528564-122528586 CAAGGGGAGCAGAAGGCCAAGGG + Intergenic
1047218187 8:122896163-122896185 CAGGGAGAACAGAAGAGCAATGG - Intronic
1047250088 8:123175411-123175433 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1047622533 8:126622567-126622589 AAGGGAGAAAATAAGGAGAAAGG - Intergenic
1047664509 8:127075973-127075995 CACAGAGAGCAAGAGGAGAAAGG - Intergenic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1048142266 8:131805944-131805966 GAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048417573 8:134243687-134243709 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048516563 8:135116771-135116793 GGAGGAGAGAAGAAGGAGAAAGG - Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048884161 8:138895713-138895735 CAGGGAGAGAAGAAAGAGTACGG + Intronic
1048998540 8:139809642-139809664 CAGGGAGAGCAGGAAGATCAGGG - Intronic
1049278565 8:141732262-141732284 CAGGGAGCCCAGAAGGACAATGG - Intergenic
1049294397 8:141823437-141823459 CAGGGAGTGGAGATGGAGCATGG - Intergenic
1049648724 8:143752909-143752931 CAGAAAGAGAAGAAAGAGAAAGG - Intergenic
1049675491 8:143887166-143887188 CAAGGAGAGGACAGGGAGAAGGG - Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1050019613 9:1269533-1269555 CACAGAGAGCAGCTGGAGAAAGG + Intergenic
1050126331 9:2359951-2359973 CAGGGACAGCAGCAAGACAATGG - Intergenic
1050155607 9:2663694-2663716 GAGGGAGAAGAGAGGGAGAATGG - Intergenic
1050266631 9:3897551-3897573 CAGGGAGATGAGACGAAGAAGGG - Intronic
1050651044 9:7777075-7777097 GAGGGAGAGGAGGAGGAAAAAGG + Intergenic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1051494112 9:17699552-17699574 CAGGGATGGCAGCAGGAGATTGG - Intronic
1051841916 9:21407509-21407531 GAGGAAGAGCAGAAGCAAAATGG - Intergenic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052738435 9:32369648-32369670 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1054991429 9:71331751-71331773 AAGGGGGAGAAAAAGGAGAAGGG + Intronic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1055365940 9:75544769-75544791 CAGGAAGGGCAGAAGATGAATGG + Intergenic
1055785335 9:79864441-79864463 AAGGGAGGCCGGAAGGAGAAAGG - Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056054180 9:82803580-82803602 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1057076159 9:92139171-92139193 CAGGGAAGGCATATGGAGAAAGG + Intergenic
1057181546 9:93033346-93033368 GAGGGAGAGGAAGAGGAGAAGGG - Intronic
1057229487 9:93311093-93311115 CAGAGAGACCAGAAGCAGAATGG - Intronic
1057420167 9:94905869-94905891 CAGGGAGTGCAGAAGGGGCTGGG + Intronic
1057729240 9:97594489-97594511 CAGGGAGCGCAGATTGGGAAGGG + Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058618790 9:106862525-106862547 GAGGCAAAGGAGAAGGAGAAGGG - Intergenic
1058775495 9:108279659-108279681 TTGGGAGATCAGAGGGAGAAGGG + Intergenic
1058782704 9:108354244-108354266 CAGTCATGGCAGAAGGAGAAGGG - Intergenic
1058841025 9:108909179-108909201 TAGGGAGAGCTTAAGGATAAGGG - Intronic
1059415991 9:114162808-114162830 CAGGGGGAGACAAAGGAGAACGG + Intronic
1059479240 9:114575622-114575644 ATGGGAGGGCAGCAGGAGAATGG - Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060166994 9:121425587-121425609 CACTCATAGCAGAAGGAGAAGGG + Intergenic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1060605827 9:124913049-124913071 CAAGCATGGCAGAAGGAGAAGGG + Intronic
1060720898 9:125976720-125976742 CAGGGAGTGGGGAAGCAGAAGGG - Intergenic
1060720904 9:125976739-125976761 AAGGGAGGGAAGAAGGAGACAGG - Intergenic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1060900949 9:127257742-127257764 CAGGGAGAAGAGAAAGGGAAAGG + Intronic
1060968404 9:127724322-127724344 CGGGACGAGCAGCAGGAGAAAGG + Exonic
1060998970 9:127891708-127891730 AAAGGAGAGGAGAGGGAGAAGGG + Intronic
1061243923 9:129391496-129391518 AAGGGAGAGGAGGTGGAGAAGGG - Intergenic
1061366903 9:130176947-130176969 CATGGGGAGGAGAAGGAGAAGGG - Intronic
1061540088 9:131273503-131273525 CAGAGAGAGAACAAGGAAAATGG + Intronic
1061598281 9:131646936-131646958 CTGGAAGAGCTGAAGGGGAAAGG + Intronic
1061868489 9:133507521-133507543 CTGGGAGACCCGAAGGAGAAGGG - Intergenic
1061943051 9:133893292-133893314 GAGGAAGGGAAGAAGGAGAAAGG + Intronic
1062236240 9:135509498-135509520 CAAGGAGAGGAGAAAGCGAAGGG + Intergenic
1062255916 9:135620336-135620358 AAGGGAGAGAAGGGGGAGAAGGG - Intergenic
1062315061 9:135963055-135963077 GAGGGAGAGGAAGAGGAGAAGGG + Intergenic
1062339932 9:136089444-136089466 CAGGCAGAGCAGAACCTGAAGGG - Intronic
1062676652 9:137749628-137749650 CAAGGAGATTAGAAAGAGAAGGG - Intronic
1185499129 X:584275-584297 GAGGGAGAGGAGGAGGGGAAGGG + Intergenic
1185499157 X:584375-584397 GAGGGAGAGGAGGAGGGGAAGGG + Intergenic
1185648017 X:1628805-1628827 ACGGGAGAGGAGAAGGAGAGAGG - Intronic
1185688323 X:1948429-1948451 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185688601 X:2133951-2133973 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185708460 X:2282618-2282640 GAGGGAGAGAAGAAGGGAAAGGG + Intronic
1185852315 X:3500683-3500705 ATGGCAGAGCAGAAGGCGAATGG + Intergenic
1185877282 X:3711914-3711936 GAGGGAGAGGAGAAAGAGAGAGG + Intronic
1186075280 X:5871674-5871696 CAGGCAGAAAAGAAGGAGAAGGG + Intronic
1186156583 X:6732581-6732603 GAGGGAGGGAGGAAGGAGAAGGG + Intergenic
1186330976 X:8534018-8534040 GAGGGAGAGAGGATGGAGAAAGG + Intronic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186689708 X:11962329-11962351 CAGGAAGAGCAGAAGGGAAAAGG + Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187421687 X:19139851-19139873 AAGGGAGAGAAGAATGTGAATGG + Intergenic
1187497475 X:19808081-19808103 CAGGGAGAGCTGCAAGAGACAGG - Intronic
1187498207 X:19814464-19814486 AGGGGAGAGCAATAGGAGAAGGG - Intronic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187584076 X:20640527-20640549 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1187819085 X:23266134-23266156 CAGGTAGATCAGAATCAGAATGG - Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188050415 X:25478536-25478558 GAGGGAGAGCAAGAGGAGGAAGG - Intergenic
1188151430 X:26681088-26681110 CAAGCAGGGCAGAAGGTGAAGGG + Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1188939357 X:36217527-36217549 ATGGGAGGGCAGCAGGAGAAAGG - Intergenic
1189110794 X:38286716-38286738 AAGGGAAAGAGGAAGGAGAAGGG - Exonic
1189274967 X:39778850-39778872 CAGGAAGAGCAGGATGAGAGAGG + Intergenic
1189366369 X:40391993-40392015 CAGGGACAGATGAACGAGAATGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189982791 X:46528040-46528062 CAGGGTGAGAGGAATGAGAAGGG + Intronic
1189988875 X:46576190-46576212 AAGGGAGAGGAGGAGGGGAAGGG - Intronic
1190399331 X:50015911-50015933 CTGGGAGAGAAGAAGGACCAAGG - Intronic
1190439496 X:50463276-50463298 GAGGGAGAGAGGAAGGAGGATGG - Intronic
1190457379 X:50639291-50639313 GAGGGAGAGTAGAGAGAGAATGG + Intronic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1191870178 X:65739063-65739085 CAGGATGAGCAGGATGAGAATGG + Exonic
1191954787 X:66632455-66632477 GAGGGTGAGGAGGAGGAGAAGGG + Intronic
1192079384 X:68032657-68032679 CAGTGACAGCAGCAGGGGAAGGG - Intergenic
1192172360 X:68864999-68865021 GGGGAAGAGCAGAGGGAGAAGGG + Intergenic
1192545041 X:72006167-72006189 CAGAGAGACCAAAAGCAGAAAGG - Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1192638289 X:72841380-72841402 TAGGGAGAGAGGAAGAAGAAAGG + Intronic
1192643425 X:72879428-72879450 TAGGGAGAGAGGAAGAAGAAAGG - Intronic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193080750 X:77403891-77403913 AAGAGAGAGCAAAAGTAGAAGGG + Intergenic
1193328314 X:80207625-80207647 CAGGGAGAGAACAAGGAGGTGGG - Intergenic
1193384353 X:80853057-80853079 AAGGGAGAGCTGAAGCAGCAAGG + Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193409279 X:81143516-81143538 CAGGGTGAGCCAAAGCAGAATGG + Intronic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1193908760 X:87277024-87277046 CAGGGTGGGGAGAAGGCGAAGGG - Intergenic
1193958883 X:87899159-87899181 CAGAGAAAGCAGAGGAAGAAGGG + Intergenic
1194620873 X:96169813-96169835 CAGAGAGAGCAGAAAGAAATGGG + Intergenic
1194701290 X:97118287-97118309 TAGGGAAAGGAGAAGGAAAATGG - Intronic
1194783209 X:98049651-98049673 AAGGGCGAGCAGAAGCAGAGTGG - Intergenic
1195006738 X:100692633-100692655 TAGTGAGAGCAGCAGGAAAAGGG + Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1195944776 X:110198135-110198157 CAGGGAAGGAAGAAGGAAAACGG + Exonic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196237581 X:113300064-113300086 CAGAGAGAGGAGGAGGGGAAGGG - Intergenic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196465503 X:115968549-115968571 CGGGGCGAACAGGAGGAGAAGGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197269029 X:124405837-124405859 AAGGAAGAACAGAAGAAGAAAGG - Intronic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197567416 X:128104605-128104627 CAGAGGGGGCAGAAAGAGAAAGG - Intergenic
1197585010 X:128336099-128336121 CAGAGAGATCAGAAACAGAATGG - Intergenic
1197691264 X:129503429-129503451 CAGGTATGGCAGACGGAGAAGGG + Intronic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1197771511 X:130092349-130092371 CAGGGAGTGCAGAGAGGGAAGGG + Intronic
1197967925 X:132084826-132084848 CAGGGAGATCACAAGAGGAAAGG + Intronic
1198322781 X:135535693-135535715 TATGGAGAGCAGATGGAAAAAGG + Intronic
1198333263 X:135641973-135641995 CATGAAGAGCAGATGGAGAATGG - Intergenic
1198555728 X:137791878-137791900 AAGGGGGAGCTGAAGGAGAGTGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198753460 X:139958778-139958800 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1198886220 X:141341498-141341520 CAGAGATAGCAGAAGGGAAATGG - Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199105583 X:143862870-143862892 CAGGAAAAGCAGAGGTAGAAGGG - Intergenic
1199124673 X:144102421-144102443 CTGAGAGAGAAGCAGGAGAATGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199708554 X:150451711-150451733 GAGGGAGATGAGGAGGAGAAGGG - Intronic
1200095657 X:153659211-153659233 GAGGAAGAGGAGAAAGAGAAAGG + Intergenic
1200375486 X:155775314-155775336 GAAGGAGGGGAGAAGGAGAAAGG - Exonic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1200827226 Y:7657990-7658012 CAGGGAGACCAGGAGAAGAGGGG + Intergenic
1200884194 Y:8252528-8252550 CAGGGAGAGCAGGAGAAGAGGGG + Intergenic
1200954520 Y:8930398-8930420 CAGGGAGACCAGGAGAAGAGGGG - Intergenic
1201300273 Y:12498833-12498855 CAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201649591 Y:16270690-16270712 CAATCACAGCAGAAGGAGAAAGG - Intergenic
1201652647 Y:16307382-16307404 GAGAGAGAGAAGAAGGAGAAGGG + Intergenic
1202195377 Y:22295060-22295082 CAGGGAGACCAGGAGAAGAGGGG + Intergenic