ID: 1153733255

View in Genome Browser
Species Human (GRCh38)
Location 18:8036917-8036939
Sequence GCAGGAAAGTTGCTGTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153733253_1153733255 0 Left 1153733253 18:8036894-8036916 CCACAGTGGCATAAATTTTAAAT 0: 1
1: 0
2: 4
3: 43
4: 452
Right 1153733255 18:8036917-8036939 GCAGGAAAGTTGCTGTTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153733255 Original CRISPR GCAGGAAAGTTGCTGTTTAC TGG Intronic
901276269 1:7993574-7993596 GAAGGAAAGTTAGTGTTTACTGG - Intergenic
908841348 1:68282859-68282881 GGAGGGCAGTGGCTGTTTACAGG - Intergenic
909353598 1:74681937-74681959 TCTGGAATGTTGCTGGTTACTGG - Intergenic
916543772 1:165783241-165783263 GCAGGTATGTTGCAGTTTGCTGG + Intronic
918245270 1:182653876-182653898 GCAGGAAAGTTTCTCATTTCAGG + Intronic
922613182 1:226944816-226944838 GCAGGAAGGTAGGTGTTTCCGGG + Intronic
1063874760 10:10462538-10462560 ACAGGAATGTTGCCTTTTACAGG - Intergenic
1065032809 10:21605031-21605053 GCAGTGAAGTGGCTGTTCACAGG - Intronic
1068825023 10:61427157-61427179 CCAGGAAAGCTGATGTTTAATGG - Intronic
1070114139 10:73512556-73512578 GGAGGAGAGTGGCTGTTCACAGG + Intronic
1070315352 10:75305653-75305675 ACTGGAAAGTTACTGTTTAAAGG - Intergenic
1071238138 10:83673469-83673491 GCAGGACAGATGTTGTTTGCCGG + Intergenic
1071525490 10:86355672-86355694 CCAGGAAACTGGCTGTTTACAGG + Intronic
1071525750 10:86357199-86357221 CCAGGAAACTGGCTGTTTCCAGG + Intronic
1072496752 10:95969178-95969200 GGTGGAAAAGTGCTGTTTACAGG + Intronic
1072507328 10:96081597-96081619 ACAGGAAAGTTTTTGTGTACAGG + Intergenic
1073315888 10:102580567-102580589 GAAGGAGAGTTGCTGTTACCAGG + Intronic
1076809751 10:132880341-132880363 GCAGGAAAGTGGGTGTTTGCTGG - Intronic
1078149794 11:8748686-8748708 GCAGGAAAGGTGCTTTTTTTAGG + Intronic
1078630382 11:12998001-12998023 GGAGGAATGTTACTGTTTAATGG - Intergenic
1079191450 11:18280888-18280910 GGAAGTAAGTTGCTGTTTAATGG + Intronic
1080016519 11:27512585-27512607 GAAGAAAAGTGGCTATTTACAGG - Intergenic
1081189805 11:40089517-40089539 GCAGGAAAGATGATATTCACGGG - Intergenic
1082625003 11:55473594-55473616 TCAGCAAAGTTGGTGTTTAGAGG + Intergenic
1082647678 11:55748324-55748346 GCAGGTCTGTTGCAGTTTACTGG - Intergenic
1083222371 11:61261124-61261146 GCAGGAGAGTTGCTGGAAACCGG + Intronic
1083714619 11:64568312-64568334 GCAGGAAGGCTGCTGTGGACCGG + Intronic
1086364009 11:86089652-86089674 GCAGAAATGTTGCTGTTTCCTGG - Intergenic
1090233128 11:125124466-125124488 GCAGCAAATTTGCTGCTTGCTGG - Intergenic
1091119745 11:133046997-133047019 GCTGGAAAGAAGCTGTTTTCTGG + Intronic
1092225051 12:6742809-6742831 GCAGGAAATTTTCTATTTAAAGG + Intergenic
1093344126 12:18019393-18019415 CCAGGGAAGTTGATGTTTATAGG - Intergenic
1093497231 12:19772132-19772154 GCAGGAAAGGAGCTGTTTTCTGG - Intergenic
1093694636 12:22146010-22146032 GCAGGAGAGTTGCTTTAAACTGG + Intronic
1094628721 12:32151281-32151303 GAAGGAAAGTGACTGTCTACTGG - Intronic
1095492535 12:42749507-42749529 GCAGGAAAGTTTGTGTTCTCTGG + Intergenic
1099566262 12:84251215-84251237 GCAGGATACTTGCTTTTCACAGG - Intergenic
1099666201 12:85632454-85632476 GCAGGGAAGTTGCATTGTACAGG - Intergenic
1100523707 12:95400521-95400543 GCATGAAAGTTGGTGTTTCAAGG - Intergenic
1103101642 12:118181256-118181278 GGAGGAAAATTGTTGTTTCCGGG - Intronic
1103924919 12:124418368-124418390 GTAGGAAAGTGGCTGTTTCACGG + Intronic
1104386448 12:128355366-128355388 ACAGTGAAGTTGCTTTTTACAGG + Intronic
1105679058 13:22706715-22706737 GCAGGATGGTTCCTGTTGACAGG - Intergenic
1107206445 13:37795713-37795735 GCAGCAAAGTTGTTGTGTAATGG - Intronic
1108823793 13:54387137-54387159 GCAGGAAGGTGGCTGCCTACAGG + Intergenic
1111701964 13:91701888-91701910 GCAGGAATGTTACTTTGTACAGG - Intronic
1112990614 13:105509182-105509204 GCCTGGAAGTTGCTGGTTACGGG - Intergenic
1115836505 14:37411041-37411063 GGAGAAAATATGCTGTTTACAGG + Intronic
1119327485 14:73769485-73769507 ACAGGAAAGCTGCTGTTGGCAGG + Intronic
1122502002 14:102207007-102207029 GCAGGTCAGGTGCTGTTTATAGG + Intronic
1124095828 15:26648127-26648149 GCAGGGGAGTTGGTGTTTAATGG - Intronic
1124154084 15:27209860-27209882 GCAGGAAGGTGGCTGTCTGCAGG - Intronic
1127791676 15:62404033-62404055 GAAGGAAACTTGCTGGTTAGAGG + Intronic
1128064047 15:64753507-64753529 CCAGGATAGCTGCTGGTTACTGG + Intronic
1130925984 15:88386267-88386289 GGATGAAAGTTGCTGTCAACTGG + Intergenic
1133183364 16:4076152-4076174 GCAGTACAGTGGCTGTTCACAGG - Intronic
1133319292 16:4903074-4903096 GCAGGAAAGATCTTGTTTTCTGG + Intronic
1135352021 16:21737316-21737338 GCAGGAGAGTTGCTGTAATCTGG - Intronic
1135450511 16:22553439-22553461 GCAGGAGAGTTGCTGTAATCTGG - Intergenic
1136991984 16:35158281-35158303 GCAGGTCTGTTGGTGTTTACTGG - Intergenic
1138252623 16:55514412-55514434 TCAGGAAACTTGCTGGTTTCAGG + Intronic
1139588546 16:67919906-67919928 ACAGGGAAGTTGCTGCTTTCTGG - Intronic
1147059055 17:37859456-37859478 GCAGTGAAGTGGCTGTTCACAGG + Intergenic
1148198144 17:45729520-45729542 GCAGGAGTGTTGATGTTTCCTGG + Intergenic
1149161342 17:53696972-53696994 TCAGGGAAGTTGCTGTTAAGAGG + Intergenic
1149228294 17:54501188-54501210 GCAGGAACTTTGCCATTTACTGG - Intergenic
1150562921 17:66310648-66310670 GAATGAAAGTTGGTGTTTAAGGG + Intronic
1152063555 17:78097172-78097194 GCAGCACAGTGGCTGTTCACAGG - Intronic
1152066093 17:78113241-78113263 GCAGGGATGTTGATGTTTATGGG - Intronic
1152680641 17:81666257-81666279 ACAGGAAAGTGGCCGTTCACCGG + Intronic
1153446813 18:5182087-5182109 CATGGAAAGTTGCTGTTTAAAGG - Intronic
1153705608 18:7741891-7741913 GCAGGGAAATTCCTGTTTATGGG + Intronic
1153711355 18:7802876-7802898 TCAGGGAAGTTACAGTTTACTGG + Intronic
1153733255 18:8036917-8036939 GCAGGAAAGTTGCTGTTTACTGG + Intronic
1156641234 18:39101918-39101940 GCAGGAAAGATGTGGTGTACTGG + Intergenic
1157870297 18:51224128-51224150 GCAGGAAAGATACTCTTTCCTGG + Intergenic
1158565072 18:58547851-58547873 GCAGGAAAGTTTCAGTTTGTGGG - Intronic
1159371392 18:67531587-67531609 TTAGGAAAGTTACTGTTCACAGG - Intergenic
1162760900 19:12887571-12887593 GCACGGTTGTTGCTGTTTACTGG - Intergenic
1163235392 19:16026815-16026837 TCAGAAAAGTTGCAGCTTACTGG - Intergenic
1163562725 19:18030020-18030042 ACAGGAGACTGGCTGTTTACAGG + Intergenic
1166351091 19:42198687-42198709 CCAAGAAGGTGGCTGTTTACTGG + Exonic
1167157669 19:47749322-47749344 GCAGGAAAGAGGCAGTTTATGGG + Intronic
929097904 2:38281320-38281342 GCAGGACACATGCTGTTAACAGG + Intergenic
929159646 2:38818600-38818622 GCAGTAAGATTGCTGCTTACTGG - Intronic
930158279 2:48127562-48127584 GGAGGAAAGCTGATGTTTTCAGG + Intergenic
930368642 2:50475987-50476009 ACAGGAAAGTTGGCTTTTACTGG - Intronic
932064782 2:68543187-68543209 GCTGGGAAGTTGTTGTTTAATGG + Intronic
938211760 2:129471671-129471693 GAATGGAAGTTACTGTTTACTGG - Intergenic
939032335 2:137091993-137092015 TCAGGAAAGTTTCTGTCTAGTGG + Intronic
939290696 2:140191263-140191285 GCTTGAATATTGCTGTTTACAGG - Intergenic
939943488 2:148380876-148380898 GCAGGTCTGTTGCAGTTTACTGG - Intronic
940654693 2:156473906-156473928 GCAGGAAAGTTGGTGTATGCTGG - Intronic
943746871 2:191471385-191471407 GCAGGAGGGTTGGTGTTTCCAGG - Intergenic
943841815 2:192593183-192593205 GCAGTAAAGTTGCTGTCAATAGG - Intergenic
946024489 2:216663887-216663909 GAAGGAAAGTTGCTGGCTGCGGG + Intronic
948417068 2:237816440-237816462 GGAAGAAATTTACTGTTTACAGG - Intronic
1171521813 20:25781918-25781940 GCAGAAAAGTGGCAGTTTCCAGG + Intronic
1171555012 20:26073965-26073987 GCAGAAAAGTGGCAGTTTCCAGG - Intergenic
1173264498 20:41466928-41466950 GCAGGCATGTTGGTTTTTACAGG - Intronic
1174399464 20:50268119-50268141 GCAGGAAAGTTGAGGTGGACTGG + Intergenic
1174476643 20:50800478-50800500 GCAGGTGAGTTACTGTTTCCAGG + Intronic
1174987743 20:55474422-55474444 GCAAGAATGCTGCTCTTTACAGG + Intergenic
1175709583 20:61208617-61208639 CCTGGAAAGATTCTGTTTACTGG - Intergenic
1176655613 21:9586854-9586876 GCAGAAAAGTGGCTGTTTCTAGG + Intergenic
1176915636 21:14622030-14622052 GCAGGTATGTTGGTGTTTGCTGG - Intronic
1177173891 21:17682979-17683001 GCAGGACAACTTCTGTTTACTGG + Intergenic
1177259438 21:18711358-18711380 GCATTACAGTTGCTGATTACTGG + Intergenic
1179599289 21:42465335-42465357 GCAGGGAAGTTCCTGTCTAGAGG + Intergenic
1181674560 22:24443274-24443296 TCAGGAAAGTGGTTGTTTCCAGG - Intergenic
1184042660 22:41953202-41953224 GAGGGAAAGATGCTGTTTCCTGG - Intergenic
949864823 3:8538806-8538828 GCAGGGATGTTACGGTTTACAGG - Intronic
951902037 3:27666472-27666494 TCAGGACTGTTGTTGTTTACTGG - Intergenic
952379070 3:32790310-32790332 GCAGGAAAATTGCTTGATACCGG + Intergenic
955684668 3:61537946-61537968 GGAGGAAATTTTCTGTTTCCTGG + Intergenic
957008967 3:74983928-74983950 GCAGGTCTGTTGCAGTTTACTGG + Intergenic
957936302 3:86948232-86948254 GCAGCAAAGTTGCTGTTGTGTGG + Intronic
960405059 3:117249700-117249722 GAAGGAAAGTTGCTATTTAAAGG + Intergenic
960622266 3:119648307-119648329 GCAGGAAAGTTGGTGGTAGCTGG + Exonic
961821303 3:129577064-129577086 ACAGGAAAGTGGCTGCTGACGGG + Intronic
964013341 3:151917253-151917275 GCAGTAAAGCTGCTGTTGAAGGG + Intergenic
964039611 3:152243556-152243578 CCAGGAAAATGTCTGTTTACTGG + Intergenic
965886321 3:173451295-173451317 GCAGGTCAGTTGGAGTTTACTGG + Intronic
966471088 3:180289782-180289804 GAAGGAAAGTTGCTGTTTCAAGG - Intergenic
966658060 3:182382383-182382405 GCAGCAAACTTGCTGGTTTCAGG + Intergenic
970262174 4:14237894-14237916 GCAGGAGATTTGTAGTTTACTGG + Intergenic
970403900 4:15743885-15743907 GTGGGACAGATGCTGTTTACTGG - Intergenic
973051713 4:45607146-45607168 CCAGGACACTTCCTGTTTACAGG + Intergenic
974103267 4:57440513-57440535 CCAGGAAAGTTGGTGTTTGGAGG - Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
975906258 4:79215693-79215715 GAAGCAGATTTGCTGTTTACTGG - Intergenic
979600008 4:122577138-122577160 GAAGGAAAGTTTTTGTTTCCTGG + Intergenic
982105573 4:152009102-152009124 GCAGGCAAGCTGCTGTCCACAGG - Intergenic
983694344 4:170510329-170510351 GCAGGTCTGTTGCAGTTTACTGG + Intergenic
984931488 4:184851446-184851468 TTAAGAAAGATGCTGTTTACGGG + Intergenic
988577217 5:32438646-32438668 GAAGGAAAGTTTCTATTTACAGG - Intronic
988661670 5:33276973-33276995 TCAGGAAAGTTGCTGCTAATAGG - Intergenic
990265155 5:54067714-54067736 CCAGGCAATGTGCTGTTTACTGG - Intronic
991538903 5:67704565-67704587 GCAGGTCTGTTGCAGTTTACTGG - Intergenic
995781921 5:115785806-115785828 GGAGGAAGGCTGCTGTTGACTGG - Intergenic
998522588 5:142814262-142814284 ACAGGGAAGTTGCAGATTACCGG - Intronic
999649950 5:153755627-153755649 GCAGTGCAGTTGCTATTTACAGG - Intronic
1000629069 5:163571554-163571576 GCATGTAAATTGCTGTTTAGAGG + Intergenic
1008201495 6:48596575-48596597 GCAGGATATTTGTTGTTAACAGG - Intergenic
1012857075 6:104514718-104514740 GCACTAAAGTTCCTGTTTTCAGG - Intergenic
1016207612 6:141488718-141488740 GCAGGTCAGTAGCTGTTTAAAGG + Intergenic
1016749511 6:147617379-147617401 TCAGAAAAGTTGCTTTTTCCGGG - Intronic
1018898486 6:168038058-168038080 GCAGGAAAGTTGCAGTTGGAAGG + Intronic
1020585791 7:10064823-10064845 GCAGGGAAGCTACTGTTCACAGG + Intergenic
1022772294 7:33486764-33486786 GCAAGCCAGTTGCTGTTTAGAGG + Intronic
1023277044 7:38531072-38531094 GCAGTGCAGTGGCTGTTTACAGG + Intronic
1023892245 7:44401389-44401411 ACAGAAACTTTGCTGTTTACAGG - Intronic
1026413100 7:70147180-70147202 GGAGTACAGTGGCTGTTTACAGG - Intronic
1029858322 7:103541262-103541284 GCAGGCAAGCTGCTGCTTTCTGG + Intronic
1031714816 7:125095992-125096014 GCGGGAAAATTGATGTTAACTGG + Intergenic
1033219066 7:139516018-139516040 TCTGGAATGTTGGTGTTTACTGG - Intergenic
1036382332 8:8244741-8244763 CCAGGACACTTCCTGTTTACAGG + Intergenic
1037886277 8:22598127-22598149 GGAAGGAAGTGGCTGTTTACCGG - Intronic
1038720887 8:30034478-30034500 GCAGAAAAGTGGCTGCTTATAGG + Intergenic
1040052398 8:43029513-43029535 TCATGAACTTTGCTGTTTACAGG + Exonic
1041202265 8:55461380-55461402 GCAGGTCTGTTGCAGTTTACTGG - Intronic
1042135785 8:65631829-65631851 GTAGTAAAGTGGCTGTTCACAGG - Intronic
1042574469 8:70202689-70202711 GAAACAGAGTTGCTGTTTACTGG + Intronic
1048557572 8:135495562-135495584 GGAGTAAAAGTGCTGTTTACTGG - Intronic
1055967552 9:81880457-81880479 GCATTACAGTTGCTGTTTATGGG - Intergenic
1056535454 9:87523838-87523860 TCAGCAAAGCTGCTGTTTCCAGG + Intronic
1057094117 9:92289382-92289404 GCAGGAAAATTTATGTTTTCTGG + Exonic
1059008121 9:110426536-110426558 GCAGAAAAGTTGCCATTTTCTGG - Intronic
1059191594 9:112333028-112333050 CCGGGGGAGTTGCTGTTTACCGG - Intronic
1059800572 9:117745801-117745823 GCAGGAAGGTTGCTATGTGCTGG - Intergenic
1060697932 9:125725282-125725304 TCAGGAAAGTTGGTATTTCCAGG - Intergenic
1061026641 9:128054054-128054076 GCAGGAAAATCGCTGATTCCAGG + Intergenic
1061193797 9:129096615-129096637 GCAGGAAACTGGCTGTCTGCTGG + Intronic
1061618867 9:131797970-131797992 GCAGGAACTTTGCTGGTTGCTGG - Intergenic
1061735212 9:132650768-132650790 GCAGCTAAGTTGCTTTCTACTGG + Intronic
1203633326 Un_KI270750v1:90269-90291 GCAGAAAAGTGGCTGTTTCTAGG + Intergenic
1188035993 X:25318165-25318187 GCAGGTCTGTTGATGTTTACTGG + Intergenic
1188185055 X:27103404-27103426 GAAGGAAAGTAGCTATGTACAGG - Intergenic
1188593053 X:31862943-31862965 CCAGGAGACTTCCTGTTTACAGG + Intronic
1188891943 X:35622520-35622542 ACAGGGAAGTTGCTGTTCAGTGG + Intergenic
1189449395 X:41113552-41113574 GCTGAAAAGATGCTGCTTACTGG + Intronic
1191151525 X:57224681-57224703 CCAGGACACTTCCTGTTTACAGG + Intergenic
1193000867 X:76560443-76560465 GCAGGTCTGTTGCTGTTTGCTGG - Intergenic
1194079878 X:89447892-89447914 CCAGGAAAGTTGCTCTTTCCAGG - Intergenic
1194969846 X:100331470-100331492 TCAGAAAAGTTGCTTTTTAGGGG - Intronic
1197263107 X:124337248-124337270 GGAGGAAAGTTTCTGTTCATGGG - Intronic
1200432498 Y:3103170-3103192 CCAGGAAAGTTGCTCTTTCCAGG - Intergenic