ID: 1153735863

View in Genome Browser
Species Human (GRCh38)
Location 18:8066537-8066559
Sequence GGGTCAATATCAATGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153735863_1153735871 6 Left 1153735863 18:8066537-8066559 CCTACCCCCATTGATATTGACCC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1153735871 18:8066566-8066588 GTTGATAGCAACACATTAGTAGG 0: 1
1: 0
2: 1
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153735863 Original CRISPR GGGTCAATATCAATGGGGGT AGG (reversed) Intronic
903349380 1:22709208-22709230 GGGTCAAGATCCACTGGGGTGGG - Intergenic
906114373 1:43346665-43346687 GGGTCAGATTCAGTGGGGGTGGG - Intronic
906133163 1:43474187-43474209 AGGTCAACATCAATGGCGATAGG + Intergenic
917220584 1:172724419-172724441 GGGTTAAGATGAATAGGGGTGGG + Intergenic
918628354 1:186684490-186684512 GGGACAAGATCACTGGGGGGGGG - Intergenic
918778829 1:188670387-188670409 GGGTCAAAATAAGTGGGGGCTGG - Intergenic
1063905068 10:10773189-10773211 GGGTCAATATAAAAGGTGGGGGG - Intergenic
1070120456 10:73571351-73571373 TGGTCAATATCAAGGTGGTTTGG - Intronic
1078764951 11:14287419-14287441 GGGTAAATATGATTGGGGGAAGG + Intronic
1079682895 11:23321084-23321106 GGGTTCATCTCAATGGGGCTTGG + Intergenic
1081449212 11:43156395-43156417 GGAGCAATATCACCGGGGGTGGG - Intergenic
1086444447 11:86858874-86858896 GGAACAATATCACAGGGGGTGGG - Intronic
1087517414 11:99181422-99181444 ATGCCAATACCAATGGGGGTGGG - Intronic
1089769025 11:120789389-120789411 GAATCAAAATCAGTGGGGGTTGG - Intronic
1093098101 12:14995069-14995091 AGGCCAATATCACTGGGGGTGGG - Intergenic
1095697497 12:45157833-45157855 GGAACCATATCACTGGGGGTAGG - Intergenic
1097435006 12:59545108-59545130 GGCACAATATCAAAGGGGATTGG - Intergenic
1098196885 12:68011755-68011777 GGGCCAAAATCAATGGTGTTGGG + Intergenic
1098479365 12:70941729-70941751 GGAACAATATCAAAGGGGGGCGG + Intergenic
1101293051 12:103390861-103390883 CTGTCCTTATCAATGGGGGTGGG - Intronic
1105466439 13:20646206-20646228 GGGTAAAGATCAATGGAGTTAGG - Intronic
1106920123 13:34554118-34554140 GGGTTAATATCTATGGGCTTGGG - Intergenic
1118838797 14:69495795-69495817 GGGTCCATGTCAAAGAGGGTGGG - Intronic
1122549072 14:102540190-102540212 GGATCTATGACAATGGGGGTGGG - Intergenic
1125488597 15:40129520-40129542 GGCACAATATCACTGGGGGTGGG + Intergenic
1131839327 15:96418527-96418549 GGGACAATATCAAATAGGGTGGG + Intergenic
1133902864 16:9993775-9993797 GGGTCTTTACGAATGGGGGTTGG - Intronic
1134820659 16:17244243-17244265 GGGTCAGAATCCCTGGGGGTGGG + Intronic
1141125543 16:81398166-81398188 GGGGCAAGATCACGGGGGGTGGG + Intergenic
1146620938 17:34397170-34397192 TGGTTAATATCATTGGAGGTGGG - Intergenic
1150148613 17:62792105-62792127 GGGTCAACACCAATGGAGGAGGG - Intronic
1152026470 17:77812632-77812654 GGGCCAACACCAATGGGGTTGGG + Intergenic
1152563768 17:81091168-81091190 GGGGCCACATAAATGGGGGTGGG - Intronic
1153735863 18:8066537-8066559 GGGTCAATATCAATGGGGGTAGG - Intronic
1156356510 18:36346661-36346683 GGGACAATTTCAATGTGGCTTGG - Intronic
1159119776 18:64155075-64155097 TGGTCAATATCCCTGGGGGTTGG + Intergenic
1162273183 19:9632907-9632929 GGCTCAAGATCGATGGAGGTAGG - Intronic
925232159 2:2243054-2243076 GGGGCAATGTCAATGGGAGCAGG + Intronic
929346889 2:40895316-40895338 GGGCCAATATCACTGTGGGTAGG - Intergenic
932950092 2:76282438-76282460 TTGTCCATATCAATGGGGGGAGG + Intergenic
933587753 2:84198432-84198454 GTGTGAATATCAATAGGAGTGGG + Intergenic
933973792 2:87491583-87491605 GGGGTAATATCACTGGGAGTAGG + Intergenic
934804428 2:97205664-97205686 GTGTCAATATCAATGTGCTTAGG - Intronic
934832903 2:97549868-97549890 GTGTCAATATCAATGTGCATAGG + Intronic
935558947 2:104541277-104541299 GGGTCATTATCCCTTGGGGTGGG + Intergenic
944862384 2:203827375-203827397 GGGACACTAGCAATGGGGGAGGG + Intergenic
945576722 2:211540152-211540174 GGGACAATATTAATGGGTGCAGG - Intronic
1178276242 21:31240196-31240218 CCATCAACATCAATGGGGGTTGG + Intronic
1182383025 22:29909279-29909301 AGGTCTGTATCACTGGGGGTTGG - Intronic
966120605 3:176515075-176515097 GGTACAATATCCATTGGGGTTGG - Intergenic
971002334 4:22337331-22337353 ATGCCAATACCAATGGGGGTGGG - Intergenic
973096764 4:46212197-46212219 GAAGCAATAACAATGGGGGTTGG + Intergenic
976080050 4:81345729-81345751 GGGTCAATTTCAGTGGGGGGTGG + Intergenic
976728923 4:88243817-88243839 GGGTCAAAATCAAAGAGGGCTGG + Intergenic
992537916 5:77730217-77730239 GGGTCATAATGAATTGGGGTAGG + Intronic
994953507 5:106497311-106497333 TGGTCAAGATTGATGGGGGTAGG - Intergenic
1002978802 6:2113290-2113312 GTGTCACTAGAAATGGGGGTGGG - Intronic
1006409878 6:33866808-33866830 GGGTCATTAGTAATGGGGGTAGG + Intergenic
1009227141 6:61030250-61030272 GGATCAATATCACCGGGGGGGGG + Intergenic
1009402381 6:63272370-63272392 GGCTCAATATCAGAGGGGGGGGG - Intergenic
1014405668 6:121047428-121047450 GGGACATTAGCAATGGGGGGGGG - Intergenic
1016080165 6:139845868-139845890 GGTTCAAAATCAATGAGGCTGGG - Intergenic
1017846939 6:158266819-158266841 CCCTCAATATCGATGGGGGTTGG - Intronic
1019390991 7:786926-786948 AGGTCAATCTGGATGGGGGTTGG + Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1046087222 8:109453163-109453185 GGTTCAATAACAATGTGGGGAGG + Intronic
1047276476 8:123409319-123409341 GAGTCCTTATCACTGGGGGTGGG - Intronic
1051606991 9:18926163-18926185 GGGGAAATATCAATGGGGGAAGG + Intergenic
1189947209 X:46191520-46191542 GGGTCAACACCCATGGAGGTAGG + Intergenic
1192338089 X:70238569-70238591 GGTTCAATATCAAGGGGATTGGG + Intronic
1193674832 X:84437658-84437680 TGGGCAACACCAATGGGGGTAGG - Intronic
1196075167 X:111568343-111568365 GGGTCACTATCAATGTGAATCGG - Intergenic
1199721431 X:150545392-150545414 GGGTCAACATCAATGGAGCAAGG + Intergenic