ID: 1153736464

View in Genome Browser
Species Human (GRCh38)
Location 18:8074186-8074208
Sequence TTGCTAAGACTACCACAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153736464 Original CRISPR TTGCTAAGACTACCACAGAT TGG (reversed) Intronic
907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG + Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
912046284 1:105462781-105462803 TTTCTAACACTACCAGAGAGGGG + Intergenic
916330908 1:163615702-163615724 TTGCCAAGAGGAACACAGATTGG + Intergenic
919336614 1:196244266-196244288 TTGCTATAACCACCACAGCTGGG - Intronic
924425195 1:243944197-243944219 TTGCCAAGACTAACCCAGACTGG + Intergenic
1071678899 10:87684676-87684698 TTACCCAGACTACCACTGATGGG + Intronic
1073449505 10:103601296-103601318 TTGCCACGCCTACCACAGGTGGG - Exonic
1080326290 11:31077188-31077210 TTTCTAAGACTTCAACAGAATGG - Intronic
1082304509 11:50554391-50554413 TTGCTGAGACCACCTCAGTTGGG - Intergenic
1082314165 11:50696484-50696506 TTGTAAAGACCACCACAGCTAGG + Intergenic
1082765837 11:57166916-57166938 TTGCTAAAAGTAACACAGTTAGG - Intergenic
1087564289 11:99834740-99834762 TTGCTGAGACTAAGATAGATGGG + Intronic
1093410493 12:18859707-18859729 TTGCCTAGACTGCAACAGATTGG + Intergenic
1095729714 12:45493322-45493344 TTTTTCAGCCTACCACAGATGGG + Intergenic
1107004308 13:35590526-35590548 ATGCCAAGAATAGCACAGATGGG - Intronic
1110780004 13:79454349-79454371 TAGCTAAAACTCCCAGAGATGGG + Intergenic
1111719317 13:91921652-91921674 TTGCCAAAACTACGGCAGATGGG + Intronic
1115783405 14:36796642-36796664 TTGCTAAGACTACCTCTCAGTGG + Intronic
1120390007 14:83894237-83894259 TTGCTATGTATACCTCAGATTGG - Intergenic
1125952291 15:43762931-43762953 TTGCCATGACTACCTCAGACAGG - Intronic
1130031781 15:80321328-80321350 TTTCTAAGACAGCCACCGATGGG - Intergenic
1153480989 18:5545644-5545666 CTGCAAAGACTAGAACAGATGGG + Intronic
1153736464 18:8074186-8074208 TTGCTAAGACTACCACAGATTGG - Intronic
1158044772 18:53142998-53143020 TTGGAAAGAATACCACAGAGGGG + Intronic
1159456893 18:68670358-68670380 TTCCTGAGACTTCCCCAGATAGG - Intergenic
1161914846 19:7220744-7220766 TTGGTAAGTCTGCCACACATCGG + Intronic
1163186861 19:15644930-15644952 TTGCTTAGACTACACCAGGTTGG - Intronic
930191015 2:48460043-48460065 TGGCTCAGGCTACGACAGATAGG - Intronic
931571529 2:63673847-63673869 TTGGTAAGATTGCCTCAGATGGG - Intronic
937800820 2:126078418-126078440 TTGCCAAGACTACCATCCATGGG + Intergenic
940458694 2:153935194-153935216 GTTCTTAGACTACCACAGTTTGG - Intronic
942204820 2:173609732-173609754 TTGCTAGGAGTAACACAGATTGG - Intergenic
945990771 2:216393630-216393652 TAGATAAGACAACCACAGAATGG - Intergenic
946219347 2:218213214-218213236 ATCCTAAGGCTTCCACAGATGGG + Intergenic
1171052914 20:21877381-21877403 TTACCAAGACTACCACTGATGGG + Intergenic
1175421380 20:58836331-58836353 CTGCTACAACTACCACCGATAGG + Intergenic
1178596847 21:33962114-33962136 TTGCTGAGACAACCACAGGTGGG - Intergenic
953364858 3:42335707-42335729 TAGTTCACACTACCACAGATGGG - Intergenic
955841937 3:63121926-63121948 TTGCTGATCTTACCACAGATGGG + Intergenic
958668590 3:97172850-97172872 TTCCTAAAACTACAACAGTTTGG - Intronic
962629247 3:137259136-137259158 CTGCTAAGAATACCATAGACTGG - Intergenic
973200628 4:47497571-47497593 AAGCTAAGACTTCTACAGATAGG - Intronic
975793367 4:77980596-77980618 TTGCTAAGTCTGCTACAGATAGG - Intergenic
977857029 4:101906854-101906876 TTGCCAAGACCACCTCAGTTGGG + Intronic
980185246 4:129453010-129453032 TTGCAAATATAACCACAGATAGG + Intergenic
980573588 4:134656681-134656703 TTGTTCAGTCTACCACTGATGGG + Intergenic
982448975 4:155529438-155529460 TTGCCTAAACTACCACAGCTGGG - Intergenic
983730403 4:170986258-170986280 TTACCCAGTCTACCACAGATGGG + Intergenic
992397829 5:76384027-76384049 TTCCTCAGACCACCCCAGATTGG + Intergenic
993503428 5:88685786-88685808 TTGCTAAGACTGACAAAAATAGG + Intergenic
995797669 5:115958937-115958959 TTGCAAAGACTTCCCCAGTTTGG - Intergenic
997803946 5:136894970-136894992 TTGCTAAGACTTCCACTGCAAGG + Intergenic
1000518279 5:162267576-162267598 CTGTAAAGACTACCACAGGTTGG - Intergenic
1004360663 6:14967956-14967978 ATGCAAAGACTTCCACAGAAGGG + Intergenic
1005577188 6:27200884-27200906 TTGCTAGGGCTACCATAGATGGG + Intergenic
1015085341 6:129283889-129283911 TTGCTAACAGTACTACAGGTAGG - Intronic
1015578675 6:134700809-134700831 CTGCAAAGACTACCATAAATTGG - Intergenic
1016404260 6:143713865-143713887 TTACCAAGACTACCCAAGATGGG + Intronic
1016489743 6:144585136-144585158 TTGCTAATTCTACCGCAAATAGG + Intronic
1020939802 7:14518067-14518089 TTACCCAGACTACCACTGATAGG - Intronic
1021139639 7:17007911-17007933 TTTCCAAGACCACCACATATAGG - Intergenic
1022446222 7:30472826-30472848 TTGCTAAAACTATCACAGACTGG - Intronic
1028166502 7:87543650-87543672 TTGCTAAGATTAAAACAAATAGG - Intronic
1032303224 7:130709122-130709144 TTGCTGAGACTGCCACAGTGGGG - Intergenic
1035532650 8:365591-365613 TTTCTAAGGGGACCACAGATGGG + Intergenic
1037084079 8:14825233-14825255 TTGCTAAGGATTTCACAGATGGG - Intronic
1042140109 8:65669256-65669278 TTGCTACTACCACCACAGACAGG - Intronic
1045060837 8:98409529-98409551 GTGCTCAGAGTTCCACAGATGGG + Intronic
1046062777 8:109158765-109158787 GTGCTTAGAATACCACAGATGGG + Intergenic
1047032970 8:120903534-120903556 TTGCTAATACTATCACAGTGGGG - Intergenic
1050049387 9:1583354-1583376 TTTTCAAGGCTACCACAGATGGG + Intergenic
1050682652 9:8131927-8131949 TTGCGAAGATGACCACAGCTTGG + Intergenic
1052293204 9:26867537-26867559 TTCTTTAGCCTACCACAGATGGG + Intronic
1052907840 9:33852465-33852487 TGGCTAAGACTTCCACACATTGG + Intronic
1056489077 9:87087257-87087279 TTCCCAAGACAGCCACAGATAGG + Intergenic
1058171575 9:101687403-101687425 TTGCTAAGAGTACCAGAGGGTGG + Intronic
1058809381 9:108624924-108624946 TTGCTAAGAGTACCCCAGTCAGG + Intergenic
1186040924 X:5477111-5477133 TTGTTAAGACTACCAGTGTTAGG - Intergenic
1186121115 X:6362067-6362089 GTGCGAAACCTACCACAGATTGG + Intergenic
1187230983 X:17423029-17423051 ATTCTAAGACCACCACAGTTTGG + Intronic
1187764434 X:22624188-22624210 TTGGTAGGAATACCACAGAAGGG - Intergenic
1189072000 X:37873815-37873837 TTGCCAAGACTTCCATAGATGGG - Intronic
1193021030 X:76793500-76793522 ATGCTAAGACTAGAACAGCTGGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195012481 X:100746619-100746641 TTGTCCACACTACCACAGATGGG + Intergenic
1197908744 X:131456621-131456643 TTGATAAGCCCACCAAAGATGGG - Intergenic
1198540863 X:137638356-137638378 TAGGTAAGATTACCACAGAGAGG + Intergenic
1201612891 Y:15862784-15862806 TTGATAAGACTGCAAGAGATTGG + Intergenic