ID: 1153737012

View in Genome Browser
Species Human (GRCh38)
Location 18:8081731-8081753
Sequence CTGTGGATGGGTCTGAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153737001_1153737012 26 Left 1153737001 18:8081682-8081704 CCCTGCTGCCGAGAAGCTTTTCT 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG 0: 1
1: 0
2: 2
3: 16
4: 336
1153737000_1153737012 27 Left 1153737000 18:8081681-8081703 CCCCTGCTGCCGAGAAGCTTTTC 0: 1
1: 0
2: 2
3: 23
4: 387
Right 1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG 0: 1
1: 0
2: 2
3: 16
4: 336
1153737002_1153737012 25 Left 1153737002 18:8081683-8081705 CCTGCTGCCGAGAAGCTTTTCTC 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG 0: 1
1: 0
2: 2
3: 16
4: 336
1153737003_1153737012 18 Left 1153737003 18:8081690-8081712 CCGAGAAGCTTTTCTCATTCTGA 0: 1
1: 0
2: 1
3: 26
4: 280
Right 1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG 0: 1
1: 0
2: 2
3: 16
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153737012 Original CRISPR CTGTGGATGGGTCTGAGATG GGG Intronic
900532487 1:3161500-3161522 TTGTGGATGGGTCGGGAATGGGG + Intronic
900779176 1:4606404-4606426 ATGTGGATGGGTCTCTGCTGGGG + Intergenic
900914911 1:5630083-5630105 ATGCAGATGGGTCTGGGATGCGG - Intergenic
901268094 1:7927846-7927868 CTGTGGAAGAGCCTGAGAAGAGG + Intronic
903156253 1:21445690-21445712 CTCTGGATGTGTCTAGGATGGGG + Intronic
903663999 1:24995783-24995805 CTGGGGATGTGTGTGGGATGGGG - Intergenic
904909069 1:33920685-33920707 CAGTGGAGGGTTCTGAGCTGAGG + Intronic
905300896 1:36985591-36985613 CCCTGGATGGGTCTCAGGTGTGG + Intronic
905745969 1:40417597-40417619 CTGAGAACAGGTCTGAGATGTGG + Intronic
906048036 1:42847391-42847413 CGGTGGAAGGGGCTGAGAAGTGG - Intronic
906060067 1:42942667-42942689 CTGTGGATGGGTATGAGTGCAGG + Intronic
906674014 1:47680113-47680135 CTGTGGCTGGGGCAGTGATGGGG - Intergenic
906783071 1:48589886-48589908 CTGGGGAAAGGTCTGACATGTGG + Intronic
906891891 1:49725519-49725541 CTGTGGTTGGCTCTAGGATGAGG + Intronic
908078146 1:60543596-60543618 ATGTGGATGAGTCTGGGAAGGGG - Intergenic
911537676 1:99119881-99119903 CAGTGGCTAGGTTTGAGATGGGG + Intergenic
912035089 1:105302072-105302094 CTGTGGGTGGGTGTCAGCTGAGG + Intergenic
913505569 1:119513682-119513704 CTGTGGTTCTGTCTGAGATTTGG - Intronic
915147762 1:153805414-153805436 CTGTGGTTGGCTGTGAGATGGGG + Exonic
915444626 1:155967649-155967671 CTGTGGATTTGCCTGAGTTGGGG - Intronic
915445835 1:155974483-155974505 CTGGGGGTGGGACTGAGAAGAGG + Intronic
916053399 1:161051482-161051504 CATTGTAGGGGTCTGAGATGTGG + Exonic
916661297 1:166924517-166924539 TTGTGGATGTCTGTGAGATGGGG - Intronic
916709342 1:167389619-167389641 CTGTGGAAGTGTCTGAATTGGGG - Exonic
919035431 1:192301810-192301832 CTGTGGATGGGACAAGGATGAGG - Intergenic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
920494709 1:206446451-206446473 CTGTGGGTGGGGCCGAGGTGGGG - Intronic
921180358 1:212626887-212626909 CTGAGCATGGGTGTGAGGTGGGG - Intergenic
921598349 1:217079771-217079793 CTGTGCCTGGCTCTGAGAGGAGG - Intronic
921687720 1:218109241-218109263 CAGGGGATGGCTCTGGGATGGGG - Intergenic
922731208 1:227949554-227949576 AGTTGGATGGGTCTCAGATGGGG - Intergenic
922998003 1:229982266-229982288 CTGTGGATGGGTCTGGGGCTGGG - Intergenic
923219433 1:231879785-231879807 CTGGAGATGGATCAGAGATGGGG + Intronic
923616033 1:235538224-235538246 TTGTGGATAGGTTTGAGTTGGGG + Intergenic
1063058300 10:2525766-2525788 CTGAGCGTGGGTCTCAGATGGGG - Intergenic
1064244967 10:13660935-13660957 CTGTGGGAGGGTCTGAGTTCTGG + Intronic
1067055753 10:43048939-43048961 CTGTGCATGGGGCTGGCATGAGG - Intergenic
1069071211 10:63992121-63992143 CAGTTAATGGGTCTGGGATGGGG + Intergenic
1069690430 10:70348240-70348262 CTGGTGATGGGGCTGGGATGAGG - Intronic
1070655694 10:78269682-78269704 CTGTGGCTGGGACTGGGATAGGG + Intergenic
1072254487 10:93608275-93608297 CTGAGACTGGGACTGAGATGGGG - Intergenic
1072284079 10:93895959-93895981 ATTTCGGTGGGTCTGAGATGGGG + Intronic
1073629945 10:105138388-105138410 CTGTGGATGGCTGTCAGATTTGG + Intronic
1075536708 10:123277616-123277638 ATGTGGTTGGGCCTGGGATGAGG - Intergenic
1075648529 10:124112311-124112333 CCCTGGATGGGGCTGAGAGGAGG - Intergenic
1075693891 10:124419321-124419343 CTGTGGCTGGGGCAGAGCTGGGG - Intergenic
1075865822 10:125718994-125719016 CTCTGGATGGGTCCGAGACTCGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078428947 11:11272514-11272536 CTGGGGAAGGATCAGAGATGAGG - Intronic
1079213115 11:18481436-18481458 CTGAGGATTGGTCTGAGCAGGGG - Intronic
1079761705 11:24337722-24337744 CTGTGACTGGCTCTGAGGTGAGG - Intergenic
1080255856 11:30289600-30289622 ATGTGGACAGGTCTGAGGTGGGG - Intergenic
1081512382 11:43789022-43789044 CTGTGGATGGCACAGAGAAGCGG - Intronic
1082686819 11:56248149-56248171 CTGTGAATGGGACTGAGTTTAGG - Intergenic
1082965786 11:58964963-58964985 CTGGGGATGGGTTAGAGATAAGG - Intronic
1083590742 11:63892599-63892621 CTCTGGATGGTTCTGGGATGAGG + Intronic
1083881643 11:65551847-65551869 CAGTGGATGGGTCAGGGATAAGG + Intronic
1084491494 11:69481027-69481049 CTGGGCATGGGGCTGAGGTGGGG + Intergenic
1084517646 11:69645162-69645184 GTCTGGATGGGTCTGGGGTGGGG + Intronic
1085455310 11:76662124-76662146 TTGTGGATGCTTCCGAGATGTGG + Intronic
1085521659 11:77142718-77142740 GTGTGGATGGACCTGAGATTGGG + Exonic
1086405509 11:86495970-86495992 CTGGGGGTGGGAATGAGATGAGG - Intronic
1086684022 11:89709472-89709494 CTGTGGATAGAGCTGACATGTGG + Intergenic
1089318132 11:117605915-117605937 CCCTGGATGGGTTGGAGATGGGG + Intronic
1091375635 12:23066-23088 CTGTGCTGGGGCCTGAGATGGGG + Intergenic
1092008406 12:5088502-5088524 CTGTGGCTGGATCTGTGATGTGG + Intergenic
1092009396 12:5097079-5097101 CTGTGGATGGGTGTGCAGTGGGG - Intergenic
1094679689 12:32657258-32657280 CTGTTTATGGGGCTGTGATGTGG + Intergenic
1096413867 12:51395937-51395959 CTGAGCATGGGAATGAGATGAGG - Intronic
1096562883 12:52449591-52449613 CCACGGATGTGTCTGAGATGTGG + Exonic
1096565034 12:52471254-52471276 CCACGGATGTGTCTGAGATGTGG + Exonic
1096981928 12:55733042-55733064 CAGAGGTTGGGTCTGAAATGGGG + Intergenic
1097259965 12:57713534-57713556 CTGTGGGTGGGGCTGAGTGGAGG + Intronic
1098887000 12:75970337-75970359 CTATGGATGGCTCAGAGCTGGGG - Intergenic
1101316719 12:103635606-103635628 CTGTGCATGGGGCTGAGGAGAGG - Intronic
1101337341 12:103808142-103808164 CTGTGGATGGCACTGATCTGTGG + Intronic
1101414142 12:104494130-104494152 CTGTGGATGGGCCAGGAATGTGG - Intronic
1102691675 12:114766230-114766252 CTGTGCATGGGTCTGGGGGGGGG - Intergenic
1103535029 12:121628071-121628093 CTGCGGATGGGCCTGAGAAGTGG + Intronic
1104213057 12:126708839-126708861 CTGTGGCTGGGCCAGTGATGGGG - Intergenic
1104430720 12:128713815-128713837 CTGTGGATGTGTCCTTGATGAGG + Intergenic
1104477282 12:129081303-129081325 TTGTGGTTTTGTCTGAGATGGGG + Intronic
1105620753 13:22063739-22063761 CTGTGGAAGGCTCCCAGATGAGG + Intergenic
1105843998 13:24279374-24279396 CTGTGGATGATTCTGAGCAGAGG + Intronic
1108606003 13:52039247-52039269 GTGTGGATGGGAGTGAGCTGAGG + Intronic
1108829852 13:54464208-54464230 TTGTGGATGGGTCTGACCGGAGG + Intergenic
1113140705 13:107146178-107146200 TTGTTGATGGGTCTGAGTAGGGG + Intergenic
1117008385 14:51445351-51445373 CAGTGGTTGGGTCTGGGTTGAGG + Intergenic
1117512821 14:56470913-56470935 CTGGGGATGGGGATGACATGTGG + Intergenic
1118337568 14:64867173-64867195 CTATGGATGGGACGGAGGTGAGG - Intronic
1118571211 14:67197336-67197358 CTGTGGCTCGGCCTGAGTTGAGG + Exonic
1118846027 14:69548370-69548392 CTGTGGATGGCTCTGGAGTGAGG - Intergenic
1118910764 14:70060310-70060332 ATGTGGGGGGGTCTGGGATGGGG - Intronic
1119331533 14:73798212-73798234 TTTTGGATGGCTCAGAGATGTGG + Intergenic
1120561294 14:85996345-85996367 GTGTGGTTGGCTCTGAGAAGTGG - Intergenic
1121981409 14:98457646-98457668 GTGAGGATGTGTCTGAGGTGGGG - Intergenic
1122831591 14:104400029-104400051 CTGTGGATGGGGCTTTGTTGTGG + Intergenic
1124250877 15:28105930-28105952 GTGTGCATGTGTCTGGGATGTGG + Intergenic
1124544273 15:30612527-30612549 CTGAGGATGGGGCTGTGAGGGGG + Intronic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1126778423 15:52118990-52119012 CTATGGATGGGGAGGAGATGGGG + Exonic
1129229965 15:74191624-74191646 GTGTGGATGGGGCTGACCTGTGG + Intronic
1129244235 15:74270027-74270049 CTTTGGATGGGTCTGGGGTCTGG - Intronic
1130353680 15:83111621-83111643 GTGTGGAGGGGTCTCAGTTGAGG + Intronic
1130367693 15:83254882-83254904 CACTGGATGGTTTTGAGATGAGG + Intergenic
1130736483 15:86555660-86555682 CATTGGATGAGTCTGAGATTGGG + Intronic
1131084707 15:89566618-89566640 CTGAGGAAGGGTGGGAGATGGGG - Intergenic
1133660433 16:7911053-7911075 CTGAGGAGGGTCCTGAGATGTGG + Intergenic
1134625733 16:15721229-15721251 TCGAGGATGGGTCTGAGTTGGGG - Intronic
1136163961 16:28440222-28440244 CTGTGCATGGGGCTCAGATCAGG + Intergenic
1136199003 16:28674760-28674782 CTGTGCATGGGGCTCAGATCAGG - Intergenic
1136215350 16:28788934-28788956 CTGTGCATGGGGCTCAGATCAGG - Intergenic
1136260076 16:29068778-29068800 CTGTGCATGGGGCTCAGATCAGG - Intergenic
1136714441 16:32265647-32265669 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136753448 16:32663770-32663792 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1136814665 16:33206595-33206617 TTGTGGATGGCTCTGGGCTGGGG + Intronic
1136821141 16:33316675-33316697 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136827704 16:33373214-33373236 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136832770 16:33471985-33472007 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136907962 16:34119722-34119744 CTGGTGATGGTTCTGAGTTGAGG - Intergenic
1137408977 16:48212008-48212030 CTGTGGAGGGGGCAGAGATGAGG - Intronic
1137523604 16:49214240-49214262 GTGTGGATGGATCAGAGTTGGGG + Intergenic
1138089310 16:54161243-54161265 CTGTGTATGGTTCTGACATTTGG + Intergenic
1138663676 16:58543877-58543899 CTGTGGATGGGCCTGAAACAAGG + Exonic
1139317120 16:66082263-66082285 CTGGGGAGGGGTCTGAGATTCGG - Intergenic
1139357614 16:66376660-66376682 CTGTGGCTGGCACTCAGATGTGG + Intronic
1139782474 16:69363448-69363470 AAGTGGATGGGGCTGAGATCTGG + Intronic
1139825584 16:69754741-69754763 GTGCGGGTGGGTCTGAGCTGGGG - Intronic
1141615204 16:85206324-85206346 CGGTGGAAGGGTCTCAGCTGGGG + Intergenic
1141892184 16:86933781-86933803 CTGAGGATGGCTCTCAGATAGGG + Intergenic
1202993241 16_KI270728v1_random:29569-29591 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1203055609 16_KI270728v1_random:924122-924144 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1142505543 17:361113-361135 CTGTACATGGGCCTGTGATGGGG - Intronic
1142884566 17:2904615-2904637 CTGGGGCTGGGTGTGAGAAGAGG - Intronic
1142931423 17:3287246-3287268 CTGTGGATGTATCAGAAATGTGG - Intergenic
1143471509 17:7178600-7178622 CTGAGGCTGGGGCTGAGGTGGGG + Intronic
1143725570 17:8842968-8842990 CTTTGCATGGGTCTGAGGAGGGG - Intronic
1143794536 17:9326064-9326086 CACTAGATGGGTCTGTGATGAGG + Intronic
1144698246 17:17320423-17320445 CTGGGGATGGATCTGATATTGGG + Intronic
1144832090 17:18137454-18137476 CTGTGGAGGGTTGTGAGCTGAGG + Intronic
1145251036 17:21297177-21297199 CGGTGCGTGGCTCTGAGATGGGG + Intronic
1146554836 17:33814355-33814377 GTGTGTATGTGTCTGTGATGTGG + Intronic
1147248636 17:39139261-39139283 CTGTAGATGGGGCAGAAATGGGG + Intronic
1147429083 17:40360838-40360860 GTGTGGAGGGGTCTGGGTTGTGG + Exonic
1147760421 17:42794646-42794668 CATTGGATGGGTCTGGGAGGGGG - Exonic
1147855288 17:43475248-43475270 CAGTGGAGGGGGATGAGATGAGG + Intergenic
1148830459 17:50427452-50427474 CAGTAGATGGGATTGAGATGAGG + Intronic
1150361716 17:64541048-64541070 CTGGAGGTGGGGCTGAGATGGGG - Intronic
1151289392 17:73138588-73138610 CTGTGTATGGGTGTTATATGTGG - Intergenic
1152092261 17:78253470-78253492 CAGAGGAGGGTTCTGAGATGTGG - Intergenic
1152130034 17:78470845-78470867 CTGTGGATGACTCTGAAAGGGGG - Intronic
1152932224 17:83115773-83115795 CTGTGGTTGGGTCTGAGGTGAGG + Intergenic
1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG + Intronic
1154205616 18:12334346-12334368 CTGTGGATGGGTGGGAGAACTGG + Intronic
1156965370 18:43085000-43085022 CTGTGGATGAAGCTGGGATGAGG + Intronic
1159256948 18:65958896-65958918 CTGTGGGTGGGAAAGAGATGTGG + Intergenic
1160460210 18:79033482-79033504 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460353 18:79034296-79034318 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460379 18:79034444-79034466 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460431 18:79034740-79034762 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460664 18:79036072-79036094 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1160460767 18:79036664-79036686 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460780 18:79036738-79036760 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460819 18:79036960-79036982 TTGTGGAAGGCTCTGAGATATGG - Intergenic
1160460832 18:79037034-79037056 CTGTGAAAGGCTCTGAGATATGG - Intergenic
1160738037 19:673698-673720 CTGCAGATGGGACTGAGTTGAGG - Intergenic
1161057103 19:2196139-2196161 GTGCGGAGGGGTCTGAGCTGGGG - Intronic
1161519427 19:4715491-4715513 CTGTGAATGGGACAGACATGGGG - Intronic
1161872113 19:6878240-6878262 CTGGGGATGGGGATGGGATGAGG - Intergenic
1162012989 19:7829547-7829569 CGGGGGTTGGGTCTGAGAAGGGG - Intergenic
1162752888 19:12839295-12839317 CTGTGCATGGTTCTGACCTGTGG - Intronic
1162958394 19:14112460-14112482 CTGGGGATGGATCTGGGATCAGG - Intronic
1164483404 19:28633347-28633369 CTGTGGATGGGTATCAGTTGTGG - Intergenic
1164517055 19:28945439-28945461 CTGTGGATGGGCCAGGGAGGAGG - Intergenic
1166302935 19:41922420-41922442 AGATGGATGGGACTGAGATGCGG + Intronic
1166892459 19:46001740-46001762 CTGTGGATGGGCCTGGGGGGTGG + Intronic
1167166322 19:47802494-47802516 CTGAGAATGGGCCTGAGATTGGG + Exonic
1167414293 19:49362149-49362171 CTGCGGCTGGGTCTGAGTTTGGG - Intronic
1167644103 19:50696416-50696438 GTGGGGATGGGTCGGGGATGGGG - Intronic
1167652771 19:50742103-50742125 ATGTGGGTGGGTCTGAGCTCTGG + Intergenic
1168088149 19:54063602-54063624 CGGTGGGTGGGTCTGGGCTGTGG - Intronic
925056107 2:858541-858563 CTGTTGAGGGGTTTGAGGTGTGG + Intergenic
925907363 2:8547467-8547489 CTGTCCAGGGGTCAGAGATGAGG - Intergenic
926559776 2:14403267-14403289 CTGGGAATGGGTATGACATGGGG - Intergenic
929591744 2:43152337-43152359 ATGTGGATGCCTCTGAGCTGCGG + Intergenic
931706004 2:64946664-64946686 CTGCTGCTGGGTCCGAGATGCGG + Intergenic
933215648 2:79626828-79626850 TCTTGGAGGGGTCTGAGATGAGG + Intronic
935673168 2:105572559-105572581 TTGTGGGTGGGTCTGAGACCAGG + Intergenic
937323487 2:120974734-120974756 CTGTGGGCGGGGCTGAGTTGAGG + Intronic
937821164 2:126312763-126312785 CTGTGGATGGGCCTGGGAATTGG - Intergenic
939045824 2:137248666-137248688 GTGTGGATGGTTCTGTGAAGAGG - Intronic
939893143 2:147760975-147760997 GTGTGGAGTGGTGTGAGATGAGG - Intergenic
939974202 2:148697444-148697466 CTATGAATGGGTCAGAGAAGAGG + Intronic
944525438 2:200614118-200614140 CTGTGGGTGGGTATGAGTTTAGG + Intronic
945051872 2:205831776-205831798 CTCTGGATGGTTTTGTGATGTGG + Intergenic
945217126 2:207445489-207445511 CTGTTGCTTGCTCTGAGATGTGG - Intergenic
945282358 2:208047906-208047928 CTCCGGATGTGTCTGAGAAGAGG - Intergenic
945945914 2:215995321-215995343 CTTTGGAGGGGTTAGAGATGTGG - Intronic
946918052 2:224546950-224546972 CTGTTAATGGGTATGATATGGGG - Intronic
947814273 2:233025466-233025488 ATGTGGGTGGGTGTGAGTTGGGG + Intergenic
947963506 2:234259795-234259817 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963516 2:234259836-234259858 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963526 2:234259871-234259893 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963555 2:234260020-234260042 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963561 2:234260043-234260065 CTGAGGCTGGGACTGAGGTGAGG - Intergenic
948274191 2:236695540-236695562 CTGTGGATGGCTCAGAGGTAAGG - Intergenic
948298158 2:236879821-236879843 CTAAGCAGGGGTCTGAGATGAGG - Intergenic
948696984 2:239737540-239737562 CTGTGGCTGGGGCTGGGCTGGGG - Intergenic
948697026 2:239737634-239737656 CTGTGGCTGGGGCTGGGCTGGGG - Intergenic
948697355 2:239738290-239738312 CTGTGGCTGGGGCTGGGCTGGGG - Intergenic
1169058215 20:2641287-2641309 CCACGGATGAGTCTGAGATGGGG - Exonic
1169321051 20:4633605-4633627 CTTTGGAAAGGGCTGAGATGTGG - Intergenic
1171301680 20:24066575-24066597 CTTGGGGTGGGTCTGAGAAGAGG - Intergenic
1171442515 20:25176702-25176724 CTGAGGATGGGTGTGAGATGTGG - Intergenic
1171903398 20:30878287-30878309 CTGGTGATGGTTCTGAGTTGAGG - Intergenic
1172427659 20:34866211-34866233 CTGAAGATGGGAATGAGATGGGG + Intronic
1173030882 20:39358543-39358565 CTGTGGATGGATATGAGAGCAGG - Intergenic
1173707860 20:45125630-45125652 GTGTGGAAGGGACTGAGTTGGGG + Intergenic
1173837952 20:46138143-46138165 CTGTGGCTGGGGCTGAGGAGGGG + Intergenic
1173857098 20:46257465-46257487 ATGTTGATGGGTCAGAAATGGGG + Intronic
1173911620 20:46674926-46674948 CAGTCGATGGGGCTGGGATGAGG + Intronic
1174081782 20:47975043-47975065 TTGTGGATGTCTCTGAGAAGAGG - Intergenic
1174531111 20:51215030-51215052 CTGTGGATGGGGAGTAGATGCGG + Intergenic
1174944224 20:54967036-54967058 CTGTGGAGGGGTAAGACATGAGG + Intergenic
1175502642 20:59461261-59461283 TGGTGGAGGGGTCCGAGATGGGG + Intergenic
1175809640 20:61851070-61851092 CTGCAGATGGGTCGGGGATGGGG + Intronic
1175902083 20:62363914-62363936 CTGGGGCAAGGTCTGAGATGGGG - Intronic
1176059741 20:63167435-63167457 CTGCGGTGGGGGCTGAGATGGGG - Intergenic
1176185771 20:63778026-63778048 CTGGGGAGGGGTCTCGGATGAGG + Intronic
1176938354 21:14893585-14893607 CTGGGGAAGGGACTGTGATGAGG - Intergenic
1179061657 21:37984815-37984837 TAGTGGATGGGGCTGGGATGAGG + Intronic
1179896294 21:44365533-44365555 CTGTTGTTGGGTTTCAGATGAGG + Intronic
1181052194 22:20243216-20243238 CTGGGGCTGGGTCCAAGATGTGG + Intronic
1183394441 22:37563161-37563183 CTGTAGAAGGGTCTGCCATGTGG - Intronic
1185388647 22:50547746-50547768 CTGGGGCTGGGGCTGAGGTGGGG - Intergenic
949857230 3:8472897-8472919 CTGGGGAAGGGTCTCACATGGGG - Intergenic
949901169 3:8815883-8815905 CTGTGGGGGGGAGTGAGATGGGG - Intronic
950016182 3:9756711-9756733 CTGTTGATGGGTCACAGAAGGGG + Intronic
951688433 3:25370653-25370675 CTGGGGATGGGTAGGAGAGGAGG + Intronic
952409499 3:33034474-33034496 CAGTGACTGGGTTTGAGATGTGG + Intronic
954063479 3:48088451-48088473 CTCTGGATGGGGCTGAGCCGCGG - Intronic
954459782 3:50619700-50619722 CTGTGGGTGAGTCAGGGATGGGG + Intronic
954854086 3:53627603-53627625 CTGTGGATGGGTGGGGGGTGGGG + Intronic
957827016 3:85460712-85460734 GTGTGGGTGGGTGGGAGATGTGG + Intronic
957934465 3:86924670-86924692 CTGTAGGTGGGGCTGAGTTGTGG + Intergenic
959505534 3:107152577-107152599 CTGTGGGGGGCTCTGAGATTGGG - Intergenic
959905273 3:111704295-111704317 CTGTGACTGGCTCTGAGGTGAGG - Intronic
960509524 3:118531649-118531671 CTTGGGGTGGCTCTGAGATGGGG - Intergenic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
964650386 3:159004882-159004904 ATGGGGATGCGTATGAGATGGGG + Intronic
965672313 3:171159246-171159268 CTGTGGACAGATCTGACATGTGG + Intronic
966037173 3:175433241-175433263 CTGTGAATGTTTCTTAGATGAGG - Intronic
967332681 3:188307380-188307402 CTGTGGGTGGGACTCAGACGTGG + Intronic
967742712 3:193020973-193020995 CTGTGGTGGGGTCTGAGCTGTGG + Intergenic
968197904 3:196724515-196724537 CTTTGGATGGGGATGAGATTTGG + Intronic
969086115 4:4657770-4657792 CTGTGCATGTGTCTCAGAGGTGG + Intergenic
970322681 4:14890794-14890816 CTGGGGTTGGGGCTGGGATGTGG - Intergenic
981023630 4:140053960-140053982 CTGTGGTTAGGTCTAAGAAGAGG + Intronic
981800524 4:148650075-148650097 ATGTGGATGAGTCAGATATGAGG + Intergenic
981880486 4:149605360-149605382 ATGTGGGTGGGACTGTGATGTGG + Intergenic
982613978 4:157616687-157616709 CTGAGGATGGGTCAGTGATAGGG - Intergenic
984187171 4:176559583-176559605 CAGTGGCTGGTTCTGATATGTGG - Intergenic
985877430 5:2610422-2610444 CACTGGTTGGGTCTGAGTTGAGG + Intergenic
986172943 5:5328388-5328410 CTGTGGCTGGTGCTGTGATGGGG - Intergenic
986572734 5:9181871-9181893 CTGCGGCTGGGAGTGAGATGGGG - Intronic
988181228 5:27796826-27796848 CAGTGGCTGGAGCTGAGATGGGG - Intergenic
993457335 5:88141563-88141585 CGGGGGCTGGGTCTGAGAGGCGG + Intergenic
995088532 5:108143790-108143812 CTGTGGATGTGTCTGCAATTTGG + Intronic
997751842 5:136354380-136354402 TAGTGGTTGGGTCTCAGATGGGG + Intronic
997900926 5:137763425-137763447 CTGTGCATGGGTATGTGCTGGGG - Intergenic
997975562 5:138439678-138439700 CTGGTGATGGCTCTGAGCTGCGG - Intronic
1001961387 5:175882176-175882198 CTGTGCCTGTGTCTGTGATGGGG + Exonic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1002685475 5:181005900-181005922 CTGTGTCTGGGTCTGTGGTGTGG - Exonic
1004177348 6:13351272-13351294 CTGTAGATGGGTCAGGGATATGG + Intergenic
1004800335 6:19139847-19139869 CTGTGGAAGGGTTCTAGATGGGG - Intergenic
1006168944 6:32081982-32082004 GTGTGCATGGGGCTGAGAAGGGG + Intronic
1006924481 6:37647075-37647097 CAGAGGAAGGGTCGGAGATGGGG - Intronic
1007523981 6:42474902-42474924 CTGTGCTAGGGTCTGTGATGAGG - Intergenic
1007785832 6:44278691-44278713 CTGTGCATGTGTGGGAGATGAGG - Exonic
1008139761 6:47818576-47818598 CTGTGTATGGGGCACAGATGAGG + Intronic
1009376434 6:62976470-62976492 AAGTGTATTGGTCTGAGATGGGG + Intergenic
1010739526 6:79483656-79483678 CTGTTGAGGGGTCGGGGATGAGG - Intergenic
1010754800 6:79655065-79655087 GTGTGGGGGGGTCGGAGATGTGG + Intronic
1016898226 6:149074881-149074903 CTGTGGATTGGTTGGGGATGCGG - Exonic
1016995374 6:149958851-149958873 CTGTTGCTGGCTCTGAGATGTGG - Intergenic
1017003237 6:150010653-150010675 CTGTTGCTGGCTCTGAGATGTGG + Intergenic
1017012848 6:150074691-150074713 CTGTTGCTGGCTCTGAGATGTGG + Intergenic
1018103632 6:160463396-160463418 TTGTGGTTGGGTCTGCCATGTGG - Intergenic
1018131332 6:160734873-160734895 TTGTGGTTGGGTCTGCCATGTGG + Intronic
1018349064 6:162937317-162937339 CTGTGGTTGTGTTTGAAATGTGG - Intronic
1018686835 6:166309732-166309754 CTCTGGATGGGTGTGGGAAGAGG + Intergenic
1018966163 6:168490793-168490815 CTGTGGCTGAGTCTGGGCTGAGG + Intronic
1019504774 7:1385402-1385424 CAGTGGCCGGGTCTGAGCTGGGG - Intergenic
1019809952 7:3158037-3158059 CTGTGGTGGGGTCTGTGCTGGGG - Intronic
1021476149 7:21063592-21063614 CAGTGGTTGGGGATGAGATGGGG + Intergenic
1024465437 7:49707218-49707240 CTCTGGCTTGGTCTGAGCTGGGG - Intergenic
1024615164 7:51105747-51105769 CAGAGGGTGGATCTGAGATGGGG - Intronic
1024850783 7:53714260-53714282 TTGTTGCTGGCTCTGAGATGTGG - Intergenic
1024936893 7:54719792-54719814 GTGTGAATGGGTGTGAGGTGGGG - Intergenic
1026109235 7:67445664-67445686 GTGAGGATGGGTCTGCAATGAGG - Intergenic
1029548295 7:101222797-101222819 CGGGGGATGGGACTGAGAGGAGG + Intronic
1030907298 7:115202604-115202626 CATTGGATGGCTTTGAGATGAGG - Intergenic
1031309259 7:120173985-120174007 CTGTGCATCGATCTCAGATGTGG + Intergenic
1032264566 7:130362076-130362098 CTGGGGAGGGGTCTGAGGTTTGG - Intronic
1032414556 7:131726169-131726191 CAGGGGGTGGCTCTGAGATGAGG + Intergenic
1032742657 7:134754202-134754224 CTGTGCTGGGGCCTGAGATGTGG + Intronic
1032954107 7:136950548-136950570 CAGTGGATGGTTTTGAGATTGGG - Intronic
1033544166 7:142384931-142384953 CAGTGGAGTGGTGTGAGATGAGG - Intergenic
1033622033 7:143070205-143070227 CTGAGGATGGTCCTGGGATGTGG - Intergenic
1033791312 7:144795593-144795615 CTGGGGATGGGGTTGAGTTGGGG - Intronic
1034041322 7:147880205-147880227 CTGTGTATGGGACTCAGGTGTGG - Intronic
1034352423 7:150425823-150425845 CTGTGTGTGTGTTTGAGATGGGG + Intergenic
1034552939 7:151832752-151832774 CTGAGGATGGGCCTCAGAGGTGG - Intronic
1036702944 8:11025190-11025212 CTGTGGATGGGTGTGTGTTTGGG - Intronic
1037289861 8:17338944-17338966 GACTGGATGGTTCTGAGATGAGG + Intronic
1037435737 8:18861345-18861367 CTGAGGATGGGACTGTGAGGAGG - Intronic
1037748137 8:21662665-21662687 CTGGGGAGGGGTCTGAGGTGAGG - Intergenic
1038368344 8:26961127-26961149 CTGTGGATGGGGCTGGCGTGGGG - Intergenic
1039064785 8:33598921-33598943 CTGTCTAGGGGTGTGAGATGGGG - Intronic
1041076273 8:54172972-54172994 CTGTGGTCGGTGCTGAGATGGGG + Intergenic
1041381362 8:57257674-57257696 ATGGGGATAGGTCTGAGCTGTGG - Intergenic
1043441966 8:80284240-80284262 CGATGGGTGAGTCTGAGATGTGG - Intergenic
1044725269 8:95189739-95189761 CTGTGGTTGGCGCTGAGCTGTGG - Intergenic
1049264248 8:141658832-141658854 ACGTGGATGGGTCAGTGATGGGG - Intergenic
1051094724 9:13453541-13453563 GTGTTAATGGTTCTGAGATGTGG + Intergenic
1051848014 9:21474702-21474724 CTGTGGATGGGATAGAGATCAGG - Intergenic
1052529446 9:29662204-29662226 CTGTGTATGTTTCTGATATGTGG - Intergenic
1057695760 9:97322014-97322036 CAGTGGAAGGTTCTGAGCTGGGG + Intronic
1057930564 9:99189538-99189560 CTGTGGGTGGGTCTTGTATGTGG - Intergenic
1058590004 9:106555196-106555218 CTGTGGATGATTCTTTGATGGGG + Intergenic
1059367104 9:113794787-113794809 CTGAGGTGGGGTCTGAGGTGGGG + Intergenic
1059442693 9:114318459-114318481 GTGTGGGTGGGTGTGATATGTGG + Intergenic
1060603585 9:124894937-124894959 TTGTGGATGGGTCTCTGTTGTGG - Intronic
1060603588 9:124894954-124894976 TTGTGGATGGGTCTCTGTTGTGG - Intronic
1060603594 9:124894988-124895010 TTGTGGATGGGTCTCTGTTGTGG - Intronic
1060603703 9:124895714-124895736 TTGTGGATGGTTCTGTGTTGTGG - Intronic
1061400523 9:130365828-130365850 GTGGGGGTGGGGCTGAGATGGGG - Intronic
1062069183 9:134546265-134546287 ATGTGAAGGGGACTGAGATGGGG + Intergenic
1062245023 9:135561771-135561793 CTGTGGGTGGCTCTGAGCTCTGG - Exonic
1062249699 9:135587971-135587993 CTGTGGGTGGCTCTGAGCTCTGG - Intergenic
1186252212 X:7680488-7680510 ATGAGGACGTGTCTGAGATGAGG + Intergenic
1186268165 X:7854427-7854449 CTGTTAATGGATGTGAGATGAGG - Intergenic
1189024340 X:37375844-37375866 CTGGGTATGGGTCTAAGATTGGG + Intronic
1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG + Intronic
1190282249 X:48938811-48938833 CTGTGGAGGGGTCTGAGGTTGGG + Intronic
1191224725 X:58031235-58031257 CTGTGGGTGGGTCTCAGCTGTGG + Intergenic
1194234937 X:91372004-91372026 CTGTTGATGAGTGGGAGATGGGG - Intergenic
1194467737 X:94254904-94254926 CTCTGCATGTGTCTGAGATGTGG - Intergenic
1195603348 X:106773609-106773631 GTGGGGATGGGGCTGAGAAGAGG + Intronic
1196214610 X:113035799-113035821 CTGTGGATGGGCATCAGCTGAGG + Intergenic
1197555667 X:127949456-127949478 CTGTGGATGACTTTGAGATTGGG - Intergenic