ID: 1153743614

View in Genome Browser
Species Human (GRCh38)
Location 18:8154159-8154181
Sequence CAGGAGGCCCTCAATTAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153743609_1153743614 3 Left 1153743609 18:8154133-8154155 CCAGCTACATGTTTTCGACCTTC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1153743614 18:8154159-8154181 CAGGAGGCCCTCAATTAAAAGGG 0: 1
1: 0
2: 0
3: 18
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153743614 Original CRISPR CAGGAGGCCCTCAATTAAAA GGG Intronic
900230115 1:1552424-1552446 CAGGAGGCCCTAAAATCGAAGGG - Intronic
900484378 1:2914504-2914526 CAGCAGGCCCTGAAGGAAAAGGG - Intergenic
900757831 1:4449458-4449480 CAGGAGGCCCTCAATGAACTCGG + Intergenic
903577164 1:24346188-24346210 CAGGAGGGCCTCAATAAATGTGG - Intronic
904849345 1:33445745-33445767 CAGGAGGACCTAAATTATATTGG + Intergenic
905014581 1:34768605-34768627 TAGTAGGCACTCAATTAAAATGG + Intronic
909718791 1:78741327-78741349 CAGGATGGTCTCAATTATAAAGG - Intergenic
909876011 1:80804443-80804465 AAGGTGGTCCTCAATTATAATGG - Intergenic
909999887 1:82329593-82329615 CGGGAGGGCCTCAGTTTAAAGGG - Intergenic
912114433 1:106387900-106387922 CATAAAGCCCTCAATAAAAATGG + Intergenic
912431974 1:109632806-109632828 GGGCAGGCCCTCAATTAAACAGG - Intergenic
912450689 1:109765786-109765808 CAGGAAGCCCTCAATTCTACAGG - Intronic
912578704 1:110700718-110700740 CAAGAGCCACTCAATTCAAATGG - Intergenic
915694000 1:157721026-157721048 CAAGAGGCTTTCAATTATAATGG + Intergenic
918122311 1:181550483-181550505 CAAGAGGCCCTGAATCAAATGGG + Intronic
919841574 1:201613165-201613187 CAGGAGTGCCTCAATTCAGAAGG + Intergenic
921743462 1:218711911-218711933 CAGCAGGCACTCAATTAATGTGG + Intergenic
922971036 1:229738516-229738538 CAGGAGGCCTTCCATAAAAGCGG - Intergenic
923541758 1:234893338-234893360 CAGAAGGCCCTTAAATGAAAGGG - Intergenic
1063311195 10:4953956-4953978 CAGGAGGGCCACAATCAAAGAGG - Intronic
1063316597 10:5012463-5012485 CAGGAGGGCCACAATCAAAGAGG + Intronic
1063879826 10:10519780-10519802 CAGCAAGCACTCAATTCAAAAGG + Intergenic
1066605833 10:37169516-37169538 CAGGAGACCCTAAAAGAAAAGGG - Exonic
1066606616 10:37181308-37181330 CAGGAGACCCTAAAAGAAAAGGG - Intronic
1068489972 10:57710744-57710766 CAGGAATACCACAATTAAAAGGG + Intergenic
1071998966 10:91175616-91175638 AAGAAGGCCTTCAATAAAAAAGG + Intronic
1073705076 10:105973868-105973890 ATGGAGTCCATCAATTAAAAAGG + Intergenic
1074696698 10:116056243-116056265 CATGAGGCCATGAATTAGAATGG - Intergenic
1082148714 11:48704547-48704569 AAGGAGGCCTACAATGAAAAAGG - Intergenic
1083911940 11:65715011-65715033 CAGCAGGAACTCAATAAAAATGG - Intronic
1084510946 11:69603381-69603403 AAGGAGGCCCTCGGTTATAAGGG + Intergenic
1089126342 11:116179103-116179125 CAGGAGGCCCTCAAGTCACACGG - Intergenic
1091862405 12:3797680-3797702 CAGCAGGCCCTGGATTATAAAGG - Intronic
1091956008 12:4643822-4643844 CAGGAGCCTCTCACTTAAAATGG - Intronic
1094598387 12:31886355-31886377 AAGAAGGCCTTGAATTAAAAGGG + Intergenic
1095276369 12:40287942-40287964 CAGGAAGCGCTTAATAAAAAAGG + Intronic
1100397680 12:94199085-94199107 CAGGGGGCGCTAAATTTAAACGG + Intronic
1103056871 12:117828445-117828467 CAGTAAGCACTCAATAAAAATGG - Intronic
1103930459 12:124448123-124448145 CAGCAGGCTCTCAATAAAGATGG + Intronic
1104391090 12:128391109-128391131 CAGGAGTCCCTCCATTAGAGTGG - Intronic
1107801497 13:44112084-44112106 CAGCAGGCCCTCACTAAAAGTGG + Intergenic
1111845154 13:93498346-93498368 CAGTTCACCCTCAATTAAAAGGG - Intronic
1112160699 13:96864607-96864629 CAGGATGGCTACAATTAAAAAGG - Intergenic
1113146778 13:107216651-107216673 CAGGAGGCCCTGAAATGCAAGGG - Intronic
1113264358 13:108601009-108601031 CAAGAAGCCCTCAAGTAAAAAGG - Intronic
1113384747 13:109838554-109838576 CAGGAAGGCCACAATTAGAATGG - Intergenic
1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG + Intergenic
1119239242 14:73045166-73045188 AAGGAGGCACTCAATTAACTGGG + Intergenic
1122271312 14:100569474-100569496 CAGCAGGCGCTCAATAAACACGG + Intronic
1129159534 15:73739671-73739693 CAGGAGCCCCGCAATGAGAACGG + Exonic
1150677338 17:67255972-67255994 CAGAAGGGCTTAAATTAAAAAGG + Intergenic
1153743614 18:8154159-8154181 CAGGAGGCCCTCAATTAAAAGGG + Intronic
1159019851 18:63134417-63134439 AAGGAGGCCCTCACTTAACCGGG - Intronic
1160257863 18:77262615-77262637 CAGGAGGCCTTCAACTTCAATGG + Intronic
1160844490 19:1160394-1160416 CAGGAGGCCCAGTATTACAATGG + Intronic
1164802558 19:31089744-31089766 CCGGAGGCTCTGAATTGAAAAGG + Intergenic
1166521462 19:43483059-43483081 CAGTAGGCACTCAATAAATATGG + Intronic
1166596569 19:44055453-44055475 CAGAAAGCCTTCATTTAAAATGG + Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167395553 19:49226133-49226155 AATGGGGCCCTCAATTCAAACGG + Intergenic
926836441 2:17028642-17028664 CAGGCAGCCAGCAATTAAAATGG + Intergenic
929831259 2:45348590-45348612 CTGGAGGCCCTCAACTCACAGGG - Intergenic
933273479 2:80258952-80258974 AAGGAGGCCCCCATTTAAAAAGG + Intronic
937023392 2:118678672-118678694 TAGGAGGCACTCAATGAAGAAGG + Intergenic
938695745 2:133833755-133833777 AAGGTGGGCCTCAATTCAAAGGG + Intergenic
942492623 2:176505201-176505223 CAGGATCCCCTAAACTAAAATGG + Intergenic
942668340 2:178346824-178346846 CATGAATTCCTCAATTAAAATGG + Intronic
943145141 2:184034203-184034225 CAGTAGGCCCTCAAATAATGTGG + Intergenic
943360793 2:186916658-186916680 CAGGAGGCTTTCAATTACAGTGG + Intergenic
948471800 2:238186787-238186809 CAGGATGTCCTAAATTGAAAAGG - Intronic
1172643653 20:36456654-36456676 CAGTAGGCACTCAATTAATCAGG - Intronic
1172944420 20:38676237-38676259 AAGGAGGCGCTCAATAAACATGG - Intergenic
1175771385 20:61626787-61626809 CAGGAGGCTCTGAGTTACAATGG - Intronic
1176374772 21:6081583-6081605 GAGGAGGCCCTGAATTAGAAAGG + Intergenic
1178761750 21:35409876-35409898 CAGGAGGAACTCTGTTAAAATGG - Intronic
1179586048 21:42374950-42374972 CAGGAGGTCCTCACTTAATACGG - Intronic
1179748703 21:43456662-43456684 GAGGAGGCCCTGAATTAGAAAGG - Intergenic
1181952924 22:26567437-26567459 GAGGAAGCCCTGAATTAAAATGG - Intronic
1182186236 22:28405531-28405553 CATGAGTCCCTCAGTTGAAATGG - Intronic
950657750 3:14447597-14447619 CAGGAGGGACACAATTACAACGG - Exonic
951750990 3:26036325-26036347 CAGGAGGCAATGAATCAAAAAGG - Intergenic
952654536 3:35769293-35769315 CAGTAGTCACTCAAATAAAAGGG - Intronic
953872617 3:46640403-46640425 CAGGAGACCCTCAATAACAGGGG - Intergenic
954910766 3:54105583-54105605 AAGGAGGATCTCAATGAAAATGG - Intergenic
958991313 3:100849022-100849044 CAGGAGGTGCTCAATAAACAAGG + Intronic
962422686 3:135241948-135241970 CAGGATGCCCTCAAGGGAAAAGG + Intronic
962553317 3:136518922-136518944 CAGGAGACACTCAATTCAAAAGG + Intronic
962903223 3:139778875-139778897 CAGGAGGCCCCCAAGGAATAAGG - Intergenic
967941742 3:194771763-194771785 CAGGAGGCCCTCAGTAGATAGGG - Intergenic
971916029 4:32871168-32871190 TAGAAGGCACTCAATTAACATGG - Intergenic
973125483 4:46578629-46578651 CAGGTGGCCCTCAAACAGAAAGG + Intergenic
974308669 4:60175117-60175139 CTGGAGTCACTGAATTAAAAGGG + Intergenic
979220391 4:118216781-118216803 GAGGAGGCCCACAATTTTAATGG + Intronic
982149371 4:152435545-152435567 CAGGAACCCCTGCATTAAAATGG + Intronic
983411693 4:167407338-167407360 CAGAAAGTCCTTAATTAAAAAGG - Intergenic
983870597 4:172821020-172821042 CAGAAGCCCCTCAATTAAACTGG + Intronic
984120332 4:175734293-175734315 CAAAAGACCCTCAATTAAATTGG + Intronic
988508658 5:31846550-31846572 CATGATGCCCAGAATTAAAAAGG - Intronic
989184463 5:38609894-38609916 CAGGAGGACCTCCATAACAAAGG + Intergenic
990490703 5:56300260-56300282 CAGAAAGCCCTCATTTAACATGG + Intergenic
994628453 5:102251173-102251195 CATGTGGCTCTCAATTAAACTGG - Intronic
995426411 5:112028508-112028530 CAAGAGAACCACAATTAAAAAGG + Intergenic
997775989 5:136605822-136605844 AAGGAGGCCCTCAATAGAAATGG + Intergenic
998625117 5:143837610-143837632 GAAGAGGCCCTCTTTTAAAAAGG - Intergenic
998869396 5:146537259-146537281 AGTGAGGCCCTCAATTAAAAAGG + Intergenic
1001532152 5:172471025-172471047 CAGAAGGTGCTCAATCAAAATGG - Intergenic
1004349933 6:14882215-14882237 CATGAGGACCTGAAATAAAATGG + Intergenic
1005247721 6:23907919-23907941 AAGGAGTCCCTCAATCATAAAGG + Intergenic
1007627947 6:43257068-43257090 CAGGATGCACTCAATTAAGCCGG + Intronic
1010734636 6:79429839-79429861 CAGGAAGACTTCAATTAAAATGG + Intergenic
1015061478 6:128971895-128971917 CAGGAGGCTCTCATTCAAAGAGG + Intronic
1016588250 6:145714309-145714331 CAGTAAGCCCTCAATTAACATGG + Intronic
1016764721 6:147779213-147779235 GAGGAGGGCCTCAACAAAAATGG - Intergenic
1021962176 7:25884054-25884076 CAGCAGGCCTTCAATGTAAATGG - Intergenic
1023940460 7:44765823-44765845 CAGGAGCCCCTTAATCCAAACGG - Intronic
1024515716 7:50253526-50253548 CATAAAACCCTCAATTAAAAAGG - Intergenic
1034201170 7:149283836-149283858 AAGGAGGCCCTGAATTTGAAAGG - Exonic
1034479010 7:151305486-151305508 AAGGACGTACTCAATTAAAATGG - Intergenic
1035616797 8:1007953-1007975 CAGGACGCCCTCCATAAAGAAGG + Intergenic
1036122965 8:6037924-6037946 CAGAAGGGATTCAATTAAAAAGG + Intergenic
1040810842 8:51451434-51451456 CAGAAGGCCATCATTTTAAATGG - Intronic
1041725395 8:61013038-61013060 CAGGAGGGCCTCAGTGCAAATGG - Intergenic
1042747520 8:72123132-72123154 CAGGAGGTCTACAGTTAAAAAGG + Intergenic
1047615160 8:126557516-126557538 CAGGAGCCCCTCCGTGAAAAGGG + Intronic
1049039357 8:140100378-140100400 CAGGAGTGCCTCAATTCACAGGG + Intronic
1049078680 8:140422952-140422974 CAGGATGGCCACAATCAAAAAGG + Intronic
1057829381 9:98395292-98395314 CAGGAGGGCTTCAAATACAAGGG + Intronic
1058628887 9:106965443-106965465 TAGGAGGACCTCAATGAACAAGG + Intronic
1060975065 9:127760236-127760258 CACCAGGCCCTGAATTCAAAGGG - Intronic
1195756782 X:108206416-108206438 CAGGAGGACCTAAATTACACAGG + Intronic
1197662459 X:129188752-129188774 CAGGATGCACTCAATGAAAATGG + Intergenic
1198053741 X:132974028-132974050 CCAGAGGAACTCAATTAAAAAGG - Intergenic