ID: 1153747563

View in Genome Browser
Species Human (GRCh38)
Location 18:8195578-8195600
Sequence ATGTCTTTGCAGCAGCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153747562_1153747563 -1 Left 1153747562 18:8195556-8195578 CCATTAAAGACTGAAAGAAGTCA 0: 1
1: 0
2: 0
3: 34
4: 406
Right 1153747563 18:8195578-8195600 ATGTCTTTGCAGCAGCATGAAGG 0: 1
1: 1
2: 2
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153747563 Original CRISPR ATGTCTTTGCAGCAGCATGA AGG Intronic
903775249 1:25789160-25789182 AGGTCTTTGCAGCACCAACAGGG - Intergenic
903943974 1:26950402-26950424 GTGTCTTTCCAGCACCATGCTGG + Intronic
905092964 1:35444293-35444315 ATGTCTCTGCAGCACCAAAATGG - Exonic
905967607 1:42112502-42112524 TTATCTTTGCAGCAGCATCCAGG - Intergenic
906936600 1:50219276-50219298 ATGTCTTGGGAAAAGCATGAGGG + Intergenic
907242444 1:53088243-53088265 AGGTCTTTGTAGCAGCAGGAGGG + Intronic
908743824 1:67356204-67356226 ATCTCTCTGCAGCAGCTTCAGGG - Intronic
909137376 1:71818374-71818396 ATGTCTTTGCAACAGCAACAAGG + Intronic
913049053 1:115099596-115099618 ATGTTTTCCCAGCAGCATGCAGG + Intergenic
920238083 1:204522804-204522826 AAGCCTTTTCAGAAGCATGAGGG + Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1067298807 10:44991553-44991575 ATGCAATTGCAGCAGCCTGAGGG - Intronic
1068366756 10:56060827-56060849 ATGTCTTTATAGCAGCAAGCAGG + Intergenic
1069034655 10:63633809-63633831 ATGACTTTTCAGCAGCAGAAGGG + Intergenic
1069338105 10:67377269-67377291 ATGTGTATGTAGCAGCATCAGGG + Intronic
1071933073 10:90495981-90496003 ATGTCTTTGTTCCAGAATGAAGG + Intergenic
1076059931 10:127405842-127405864 CTGTCTTTGCTGCACGATGAAGG - Intronic
1076345606 10:129776920-129776942 ACGTCTTTGCAGCAACATGGAGG - Intergenic
1076485945 10:130817191-130817213 GTCTCTGTGCTGCAGCATGAGGG - Intergenic
1076835424 10:133018619-133018641 ACGTTTATGCAGCAGCAGGAGGG - Intergenic
1078709251 11:13775145-13775167 ATGTCTTTGTAGCAACATGGAGG + Intergenic
1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG + Intergenic
1083047392 11:59749141-59749163 ATTTCTTTGCTGCTGCATAAAGG - Intronic
1084406981 11:68979879-68979901 AGGACTTTGCAGCTGCATGTGGG - Intergenic
1084614693 11:70227663-70227685 CTGCCTTTGCAGCACCATGGAGG + Intergenic
1085085644 11:73664695-73664717 ATGTCCCTGCAGGAGCATGCAGG - Intergenic
1087731940 11:101788925-101788947 ATGTCTTTGCAGCAACATGGAGG + Intronic
1088514046 11:110609354-110609376 TTGTCTTTGCAGGGGCATGTTGG - Intronic
1089409315 11:118226034-118226056 ATTTCTTTGGAGCATCATGTTGG + Intergenic
1089701812 11:120249214-120249236 ATGTCTTTGCAGCAGCACAAGGG + Intronic
1090207687 11:124895035-124895057 ATGTCCTGGCAGCAGTAGGAAGG + Intronic
1090472083 11:126989756-126989778 GTGTCTCTCCTGCAGCATGAAGG + Intronic
1095536753 12:43257938-43257960 ATGTCTTTGCAGGAGGAGAATGG + Intergenic
1095837398 12:46653865-46653887 ATCACTTTGCAGCAGGAAGAAGG + Intergenic
1096728806 12:53588792-53588814 ATGTCCTTGCTGCAAAATGATGG + Intronic
1097655279 12:62353346-62353368 TCTTCTTTGCAGCAACATGATGG - Intronic
1098055583 12:66501863-66501885 ATGGCTTCACAGCAGCATGTTGG + Intronic
1099437346 12:82659920-82659942 ATGTCTTTGCAGCCACACAAAGG + Intergenic
1100375336 12:94010334-94010356 GTTTCTTTGTAGAAGCATGAGGG + Intergenic
1102525762 12:113511559-113511581 ACGTCTCTGCAGCTGCAAGAAGG - Intergenic
1102811292 12:115826309-115826331 ATGTTTTTGTAGCAGCATTTCGG - Intergenic
1103516667 12:121512824-121512846 CTGTCTTTGAGGCAGCAGGAGGG - Intronic
1103749515 12:123149984-123150006 ATGTCTCTGCAGGAGCAAGTCGG + Intronic
1108779415 13:53810723-53810745 ATGTGTTTGGAGAAACATGAAGG - Intergenic
1110065268 13:71096614-71096636 AAGTATTTGCAGTAGCATCAAGG - Intergenic
1113135148 13:107080744-107080766 GTGTGGCTGCAGCAGCATGAGGG - Intergenic
1114334319 14:21672169-21672191 GTGTCAGGGCAGCAGCATGAAGG - Intergenic
1118787982 14:69062462-69062484 ATGCCCTTTCAGCACCATGAAGG + Exonic
1119354074 14:73990677-73990699 ATGGCTTTGTTGCAGAATGATGG - Intronic
1119672674 14:76531325-76531347 GTGTCTTTGCAGCTGTATTAAGG - Intergenic
1121566661 14:94915012-94915034 ATGCCTCTGCAGCAGCACGCAGG + Intergenic
1121615968 14:95314077-95314099 ATGGCTTTGCAGCAGGGAGAGGG - Intronic
1125049169 15:35277744-35277766 AGTTCTTTGCAACAGCATAATGG - Intronic
1131663481 15:94544207-94544229 ATGTCTTCCCAGTATCATGATGG + Intergenic
1133469724 16:6063194-6063216 ATCACTTTGGAGCAGCAAGAGGG + Intronic
1134823474 16:17265715-17265737 GTGTCTTTGCAGCAGCAGCGTGG - Intronic
1135516877 16:23143518-23143540 ATGTGTTTGCAGCAGCACTAGGG - Intronic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1137764723 16:50969129-50969151 ATGTCTTTTGAGCATCATGTTGG + Intergenic
1137813655 16:51377312-51377334 ATGTCTTGGGAGCAGAATGTGGG + Intergenic
1138341401 16:56291662-56291684 ATTTTGTTGCAGCAGCATAAAGG - Intronic
1140443924 16:75008831-75008853 ATATCCTTGCAGCAGCCTTATGG - Intronic
1141469821 16:84230710-84230732 ATGTCTCTGCAGAACCATGGTGG - Intronic
1142069425 16:88082867-88082889 AAGACTTTGCAGCAACATAAAGG + Intronic
1143108283 17:4540278-4540300 GTGTGTGTGCAGCAGCGTGAGGG + Intronic
1149414229 17:56442194-56442216 ATGTGTATGCAGCTGAATGAAGG + Intronic
1149519652 17:57309003-57309025 CTGTATTTTCATCAGCATGAGGG + Intronic
1151206703 17:72513194-72513216 ATCTGTTTGCTGCAGCAGGATGG - Intergenic
1153416045 18:4846869-4846891 ATGTAATTGCATCAGCATGGTGG + Intergenic
1153521281 18:5956377-5956399 ATGTATTTGCAGCAGATCGATGG - Exonic
1153747563 18:8195578-8195600 ATGTCTTTGCAGCAGCATGAAGG + Intronic
1153848459 18:9070790-9070812 ATGGCTTTGCGTCATCATGATGG + Intergenic
1156492790 18:37506176-37506198 ATGGCTTTGCAGGAGCATCGCGG - Intronic
1156661044 18:39347079-39347101 AGGTCTCTGCACCAGCAGGATGG - Intergenic
1157393512 18:47322984-47323006 GTGTCTTTGCAGCAGAGAGAAGG + Intergenic
1159255819 18:65943809-65943831 ATGTCTGTGCTGCAGCACGTGGG - Intergenic
1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG + Intergenic
1159599886 18:70418992-70419014 ATATTCTTCCAGCAGCATGAAGG + Intergenic
1163693974 19:18753437-18753459 ATTTCTTTGCAGCCGCATGGTGG - Intronic
1166958503 19:46482693-46482715 ATATATGTGCAGCAGAATGATGG - Intronic
1167322898 19:48807293-48807315 TTGACTTTGCCGCAGCATGGAGG - Intronic
925763224 2:7206753-7206775 CTGACTTTGCAGCAGCTGGATGG - Intergenic
926908380 2:17826999-17827021 ATTTTGTTGCAGCAGCAGGAAGG - Intergenic
928590391 2:32808585-32808607 GTGTGTTTGCAGGGGCATGAAGG - Intronic
928862129 2:35871898-35871920 ATGTCGTTGTAGCATCGTGATGG + Intergenic
928975188 2:37079530-37079552 TTGGCTTTGGAGGAGCATGAAGG - Intronic
932824714 2:74928753-74928775 ATGGCTTTGTCACAGCATGATGG + Intergenic
937124182 2:119462741-119462763 TTGTCTTTGCAGCAGCCCTACGG - Intronic
938077976 2:128350967-128350989 ATCTCTTTGCAGCAGCATGAAGG + Intergenic
940657975 2:156511582-156511604 ATTTCTCTTCAGCATCATGATGG + Intronic
942034827 2:172000548-172000570 ATGCCTTTGCAGCAGAATTGGGG + Intronic
942637003 2:178018326-178018348 ATGTCTATGCAGACGCATCACGG + Intronic
942917461 2:181328592-181328614 TTCTTTTTGCAGCAGTATGAAGG - Intergenic
946557319 2:220872965-220872987 ATTTCTTTGCTGCACCATGGAGG + Intergenic
947736060 2:232456179-232456201 ATGTCTTGGGGGCAGCAGGAGGG - Exonic
1171026824 20:21638426-21638448 CTGCCTTCGCAGCAACATGAAGG - Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1174308920 20:49635246-49635268 CTGTCTTTTCATCAGCATGGCGG - Exonic
1174428101 20:50447766-50447788 GTGTCTGTGAAGCAGCAAGAAGG + Intergenic
1178448951 21:32674206-32674228 ATGTTTTTGAAACAGCAGGAAGG - Intronic
1179830467 21:43993216-43993238 ATGGCTTTGGACCAGCCTGAGGG - Intergenic
1180153938 21:45968423-45968445 TTCTCTGTGCAGCTGCATGAAGG - Intergenic
1180713533 22:17856332-17856354 TGGTCTTTTGAGCAGCATGAAGG + Intronic
1181318838 22:21989269-21989291 ATGTCTTTCCAGCAGTGTCAGGG - Intergenic
1182143470 22:27982399-27982421 CTGTCCCTGCAGCAGCATGACGG - Exonic
1183061372 22:35338287-35338309 ATGTGTTTTCAGCAGCAGAATGG + Intronic
1184201588 22:42973076-42973098 ATGTGTTTGCTGCAGTATGTGGG - Intronic
951181664 3:19666089-19666111 TTGACTTTGCAGCAGAACGAAGG - Intergenic
952109965 3:30111063-30111085 ATGTTTTTGCAGTAGCAGGAGGG + Intergenic
957798056 3:85037560-85037582 CTATCTTTACAGCAGCATGGAGG + Intronic
958617218 3:96510643-96510665 ATTTTTTCACAGCAGCATGAGGG + Intergenic
959790169 3:110350736-110350758 ATGTCATTGCAGCAAAAGGAAGG + Intergenic
961125963 3:124417926-124417948 TAGTTTTTCCAGCAGCATGAAGG + Intronic
961963933 3:130882627-130882649 ATGTCATAGCAACAGAATGAAGG - Intronic
962509960 3:136088401-136088423 ATGTCCCTGCAGCAACATGGAGG - Intronic
963308533 3:143681713-143681735 AAGACTTTTCAGCAGCCTGAGGG - Intronic
966636892 3:182145006-182145028 TTAGTTTTGCAGCAGCATGAGGG - Intergenic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
977758204 4:100698879-100698901 ATGTCTTTATAGCTTCATGAGGG + Intronic
982610209 4:157564684-157564706 ATGTTGTTGCAGAAGCATGTAGG - Intergenic
984047013 4:174814040-174814062 GTGGCTCTGCAGCAGCATCAAGG + Intronic
984280388 4:177663279-177663301 ACGACTTTGGAGCAGCATGCTGG - Intergenic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
987023508 5:13899568-13899590 GTGTATTTGGAGCAGCAGGAGGG - Intronic
987129465 5:14847433-14847455 TTGTCTTTGCTGCAACATGCAGG - Intronic
987324180 5:16797213-16797235 ATTTCTTTTCAGCATCATGTTGG - Intronic
987475859 5:18391979-18392001 ATGTCTTTGCATCAGTGAGACGG + Intergenic
987491190 5:18582276-18582298 TTGTCTGTGCAGCAGGCTGAAGG - Intergenic
988203443 5:28099695-28099717 ATTTTGTTGCAGCAGCATAAAGG + Intergenic
989323404 5:40162710-40162732 ATATTTTTTAAGCAGCATGAAGG - Intergenic
989361148 5:40602729-40602751 AGGTCTTTGCAGCAGAGTAATGG - Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990889067 5:60629148-60629170 ATGTCATTGCAGCAACATGGTGG - Intronic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
992083900 5:73260762-73260784 CTGTCTTTGCAACAAAATGACGG - Intergenic
992634669 5:78716074-78716096 CTGTCTGAGCAGCACCATGATGG - Intronic
993662850 5:90660496-90660518 ATGTCATTGCAACAACATAATGG - Intronic
994672861 5:102783712-102783734 ATGTGCATGCAGCAGTATGAGGG + Intronic
996583513 5:125058322-125058344 ATGTCACATCAGCAGCATGATGG + Intergenic
998773170 5:145569010-145569032 GTTTCTTTGAAACAGCATGAAGG - Intronic
1002357708 5:178644324-178644346 ATTTGCCTGCAGCAGCATGAAGG - Intergenic
1007588990 6:43010160-43010182 ATGGCCTCCCAGCAGCATGATGG - Intronic
1009051486 6:58282049-58282071 AGTTCTTTACAGCAGCATGAGGG + Intergenic
1009674563 6:66801375-66801397 ATTTTGTTACAGCAGCATGAAGG + Intergenic
1010516780 6:76782823-76782845 GTGTCTTGGTAGAAGCATGATGG - Intergenic
1012094314 6:94939318-94939340 TGTTCTTTGCAGCAACATGACGG + Intergenic
1013743739 6:113320183-113320205 ATGTCTTTGCAGGGGGTTGAGGG - Intergenic
1020200325 7:6074655-6074677 TTGTCTTTGCTTCATCATGAGGG - Intergenic
1020463521 7:8450164-8450186 ATGTCTTGGCAGCAGGAGGTGGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1030109287 7:106012845-106012867 GTGTCTTTTCACCAGCATTATGG + Exonic
1032916419 7:136495195-136495217 AGGTCTCTGGAGCAGCCTGATGG - Intergenic
1034051225 7:147986273-147986295 ATGCTTTTGCAACATCATGATGG + Intronic
1034509575 7:151522695-151522717 TTGACTTTGCAGCAGCTGGAAGG + Intergenic
1035003685 7:155638782-155638804 ATTTCATTACAGCAGCCTGAAGG - Intronic
1035052258 7:156005632-156005654 CTCTCTTTGCAGCAGAAGGAGGG + Intergenic
1035952183 8:4034063-4034085 TTGTCTTTGCATCGGCATGGGGG + Intronic
1037087817 8:14874865-14874887 ATGTCTTTACAGGAGCATTGTGG - Intronic
1041254548 8:55968631-55968653 TAGTCTTTTCAGCAGCCTGAGGG + Intronic
1041560715 8:59215296-59215318 ATGTGTTTGCAGCAGCAGTCTGG + Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1046190143 8:110784600-110784622 CTGTCATTGCAGCATCATGATGG - Intergenic
1048340700 8:133536566-133536588 ATGTCTCTGCTGCAGCCAGACGG + Intronic
1048596399 8:135871378-135871400 ATATTTTAGCAGCAGCAGGAAGG + Intergenic
1048785786 8:138048729-138048751 GTGTCTTTATAGCAGCATGGTGG + Intergenic
1056488213 9:87080145-87080167 ATTTCTTCACAGCAGTATGAAGG + Intergenic
1057124904 9:92609378-92609400 AAGTCTCTGGAGCAGCAGGAAGG + Intronic
1059994899 9:119899208-119899230 ATGCCTTTGCAGTAACATGGAGG - Intergenic
1186121913 X:6372550-6372572 ATGTCTGTGCAACAGGATAATGG - Intergenic
1188687077 X:33082342-33082364 ATGTCTTTGCAGCACCTAGGAGG - Intronic
1190188323 X:48255311-48255333 ATGTCATTGCTCCAGGATGATGG - Exonic
1193489420 X:82131456-82131478 ATTTCTTTGCAGTTGGATGATGG + Intergenic
1194435608 X:93865617-93865639 ATCTCTTGGCACCAGGATGAAGG + Intergenic
1195808074 X:108798000-108798022 TTGTCTTACCAGAAGCATGAAGG + Intergenic
1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG + Intergenic
1197250589 X:124212405-124212427 CAGTCTTTACAGCAGCATGATGG - Intronic
1198528889 X:137529664-137529686 ATGAGTATGCAGCAGCAAGAAGG + Intergenic
1199671995 X:150155369-150155391 TCTTCTTTGCAGCAGCATGCAGG + Intergenic
1201614220 Y:15878640-15878662 ATCTCTTTTCAGATGCATGAAGG - Intergenic
1201616148 Y:15901137-15901159 ATCTCTTTTCAGATGCATGAAGG + Intergenic
1201789299 Y:17820894-17820916 ATGACTTTGCAGAATCATGAAGG - Intergenic
1201812254 Y:18085093-18085115 ATGACTTTGCAGAATCATGAAGG + Intergenic
1202350950 Y:23990701-23990723 CTGGCTTTGCAGAATCATGAAGG - Intergenic
1202519829 Y:25679418-25679440 CTGGCTTTGCAGAATCATGAAGG + Intergenic