ID: 1153747637

View in Genome Browser
Species Human (GRCh38)
Location 18:8196357-8196379
Sequence CTCTAACAGTAATAGCACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153747637_1153747641 -1 Left 1153747637 18:8196357-8196379 CCTTAGTGCTATTACTGTTAGAG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1153747641 18:8196379-8196401 GAGATGGGAACAGGAGAGAGTGG 0: 1
1: 0
2: 6
3: 130
4: 1236
1153747637_1153747642 26 Left 1153747637 18:8196357-8196379 CCTTAGTGCTATTACTGTTAGAG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1153747642 18:8196406-8196428 AGCAGTGTTTACCTCCTTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1153747637_1153747640 -10 Left 1153747637 18:8196357-8196379 CCTTAGTGCTATTACTGTTAGAG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1153747640 18:8196370-8196392 ACTGTTAGAGAGATGGGAACAGG 0: 1
1: 0
2: 1
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153747637 Original CRISPR CTCTAACAGTAATAGCACTA AGG (reversed) Intronic
906802104 1:48746967-48746989 CTCTTAAATTAAAAGCACTAGGG - Intronic
906836925 1:49093943-49093965 CTTTAACAGAAATAGCAATGGGG + Intronic
917189329 1:172397422-172397444 CTCTAACAATAGTACCACTTAGG + Intronic
920769858 1:208872860-208872882 CTATGACAATAATAGCACAAAGG - Intergenic
920953516 1:210597021-210597043 CTCTAACTGTATTTGCATTACGG + Intronic
921274630 1:213506882-213506904 GCCTAAAAGTAATAGCACTCAGG - Intergenic
921364377 1:214359776-214359798 CTCTAAAAGTCTTAGCATTATGG + Intronic
923263010 1:232285166-232285188 CTCCATCAGTAATAGCGATATGG - Intergenic
923795187 1:237147315-237147337 CTCTTACAGTAATAGAAATAGGG - Intronic
924018311 1:239752320-239752342 CTCTGACAGAAATAGAACAATGG - Intronic
1067375497 10:45724438-45724460 CTATAACAGTGTTAACACTAAGG - Intergenic
1067883310 10:50066064-50066086 CTATAACAGTGTTAACACTAAGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1083536753 11:63476152-63476174 ATATAATAGTAATAGCACAAAGG - Intronic
1084002990 11:66307970-66307992 CTCTACCTGTAATAGCCCTTGGG + Intergenic
1084678583 11:70651573-70651595 CTCTAAGGCTAATAGCACTGGGG - Intronic
1087487809 11:98780004-98780026 ATGTAACAGTACTAGCATTATGG + Intergenic
1088763222 11:112951504-112951526 CTATAACAGTAATAATAATAAGG - Intergenic
1092645536 12:10567453-10567475 GTCCAACAGTAGTGGCACTAGGG + Intergenic
1095907557 12:47393446-47393468 CTCTAACAGATGTAGCACTTGGG - Intergenic
1097393281 12:59041746-59041768 CAATAACAGTATTAGCAATAGGG - Intergenic
1097846221 12:64369615-64369637 GTATGACAGTAATAGCACAAAGG + Intronic
1098413265 12:70203856-70203878 ATATGACAATAATAGCACTAAGG + Intergenic
1100399765 12:94218865-94218887 ATCTAACAATATTAGCAATAAGG + Intronic
1100869947 12:98899840-98899862 CTCTCACATTTATAGCACTGAGG + Intronic
1101191181 12:102334538-102334560 CTGTAACAACAATAGCACTAAGG - Intergenic
1102945263 12:116981552-116981574 GTATGACAGTAATAGCACAAAGG + Intronic
1107699418 13:43033072-43033094 CTATCACAGGAATAGCACCAAGG + Intronic
1110832232 13:80044728-80044750 CTCCACCAGTGACAGCACTAAGG + Intergenic
1112775780 13:102842920-102842942 CTTTAACAGTAATAGCAGTAGGG - Intronic
1112962735 13:105147555-105147577 CTGTAACAGTCATACCACCAAGG + Intergenic
1115910480 14:38251235-38251257 GACTAACAGGAATAGCACAAAGG + Intergenic
1127168701 15:56275627-56275649 ATATAACAATAATAGCACAAAGG - Intronic
1127454682 15:59146018-59146040 CTCTAAAAATAATAACAATAAGG - Intronic
1131823487 15:96296376-96296398 CTCCAACAGCAATAGGACGATGG + Intergenic
1134818476 16:17226351-17226373 CTATAGCACTACTAGCACTATGG + Intronic
1135796098 16:25444375-25444397 CTGTGCCAGTAATAGTACTAAGG + Intergenic
1137968645 16:52961796-52961818 CTCTAACTGGAAGAGCACAAGGG - Intergenic
1138068453 16:53966306-53966328 TTCCAAGATTAATAGCACTATGG - Intronic
1138628290 16:58270947-58270969 ATTTGACAGTAATAGCACAAAGG - Intronic
1140110802 16:72003122-72003144 CTCCACCTGTAATAGCACTTTGG - Intergenic
1142506704 17:368764-368786 GTATAACAATAATAGCACAAAGG - Intronic
1149306601 17:55353403-55353425 TTATAACAGTAATAGCACAAAGG + Intergenic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1155469758 18:26178844-26178866 CTCGAACAGTTTTAGCACTTCGG - Exonic
1159254068 18:65922635-65922657 CTCTATTGGTAATAGCACTGTGG + Intergenic
1161100934 19:2421585-2421607 CTCTAAAAATAATAACAATAAGG - Intronic
927206017 2:20611103-20611125 CTCTAACAGACATACCACAATGG - Intronic
930507124 2:52297206-52297228 CTCAAACTGTATTTGCACTATGG - Intergenic
937995128 2:127688224-127688246 ATTTAACAGTAACAGCACAAAGG - Intergenic
939201031 2:139034673-139034695 CTCTAAGAGTAAAAGCAATTTGG - Intergenic
940332958 2:152495190-152495212 TACTAACAGGAATAACACTAAGG + Intronic
942770416 2:179511294-179511316 CTCTAGCAGAGACAGCACTAAGG + Intronic
943569971 2:189562587-189562609 CTCTAGCAGTAATATAACAATGG - Intronic
945345092 2:208703725-208703747 CTCATACTCTAATAGCACTATGG + Intronic
947342058 2:229150714-229150736 CTTTAACAGTATAAGCACTGTGG + Intronic
1168884187 20:1234079-1234101 CTGAAACATCAATAGCACTATGG - Exonic
1177259967 21:18717128-18717150 CCCTAACAGTAAGAACAGTAGGG + Intergenic
1179813799 21:43890170-43890192 CTATCACAGTTACAGCACTAGGG - Intronic
950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG + Intergenic
951759779 3:26133867-26133889 ATGTAACAATAATAGCACAAAGG - Intergenic
954288817 3:49638240-49638262 CTCTAACTGTACTGGCACTCAGG + Intronic
955112821 3:55966073-55966095 TTCTACCAGTACTAGCTCTAGGG + Intronic
957479748 3:80776323-80776345 CTGTAAAATTAATAGCACAATGG - Intergenic
958035258 3:88162894-88162916 CTCTGACACTAAAAGCACAATGG - Intronic
959301867 3:104612823-104612845 CTGTAACAGCAATATCAATACGG + Intergenic
959691007 3:109198234-109198256 CTCTAAAAGAAAAGGCACTAAGG + Intergenic
964137106 3:153356395-153356417 CTCTAGGAGTAATAGCAAAAGGG - Intergenic
974205127 4:58692136-58692158 ATCTGACACTAAAAGCACTAGGG + Intergenic
975657161 4:76653265-76653287 CCCAAACAGTAACAGCACCAAGG - Intronic
978237403 4:106475525-106475547 CTCCTAAAGAAATAGCACTATGG + Intergenic
978858495 4:113420650-113420672 GTATAACAGCAATAGCACAAAGG + Intergenic
979928645 4:126601472-126601494 CTCTAACAATAAGAGTACAAAGG + Intergenic
980538099 4:134156319-134156341 TTCTAACAGTAATTGCATAAGGG + Intergenic
980790158 4:137609952-137609974 TTCCAATAGTAATAGCATTAGGG - Intergenic
982728441 4:158929698-158929720 GTCTAAAACTAATAGCACAAAGG - Intronic
985656718 5:1135611-1135633 CACTTACAGAAATGGCACTAGGG - Intergenic
988319827 5:29680425-29680447 CTATAACAGTAACAGCACAAAGG - Intergenic
993118699 5:83748450-83748472 GTATAACAGTAATAGCAAAAAGG - Intergenic
993844654 5:92925436-92925458 TTCTATCAGTCATAGCACTCAGG - Intergenic
995037774 5:107554726-107554748 CACTATCAGTAATAACCCTATGG + Intronic
995153919 5:108886765-108886787 CTCTAACAATAATAACTCCATGG - Intronic
995245214 5:109927664-109927686 AGCTAACAGTAATAGTAATAGGG - Intergenic
1000477496 5:161729415-161729437 CTCTCACAAGAATAGCACCAAGG + Intergenic
1008703928 6:54134690-54134712 CCCTAACAGTTACAGCTCTATGG + Intronic
1014700890 6:124686506-124686528 CTATAACAAGAACAGCACTAGGG + Intronic
1015542991 6:134334707-134334729 GTCTTATAGTAATAGCATTATGG - Intergenic
1017437483 6:154430127-154430149 CTCTGAAAGTATTAGCACTTAGG - Intronic
1017573808 6:155779021-155779043 CTATCACAAGAATAGCACTAGGG - Intergenic
1020749953 7:12128439-12128461 CTTTAAAAGTAATAGCAAAAGGG - Intergenic
1022671234 7:32458183-32458205 CTCTAGCAGCACTAGCACGAGGG - Intergenic
1027532353 7:79352600-79352622 CTCCAGTAATAATAGCACTATGG - Intronic
1028043098 7:86082266-86082288 AAATAACAGTAATAGCACAAAGG - Intergenic
1029687958 7:102162001-102162023 CTCTAACATAAAAAGAACTAGGG + Intronic
1031293982 7:119979642-119979664 CTATAACAACAATAGCACAAGGG + Intergenic
1031891121 7:127294350-127294372 GGCCACCAGTAATAGCACTATGG - Intergenic
1032845223 7:135746382-135746404 CCCTCACAGTAATAGCATGAGGG + Intronic
1036724319 8:11206059-11206081 CTCTAACAGCAACATCACTGAGG + Intergenic
1037366428 8:18127216-18127238 GTCTAACAGAAATAACACTGTGG - Intergenic
1038753127 8:30315387-30315409 CTTTAACAGGAAAAGCTCTAGGG + Intergenic
1038766832 8:30436618-30436640 ATCTAACACTAATACCACTTAGG + Intronic
1039232349 8:35462591-35462613 CTCTAACAATAATAATATTATGG + Intronic
1039309339 8:36298638-36298660 CTATCACAAGAATAGCACTAAGG + Intergenic
1040711049 8:50189078-50189100 GTCTCACAGGAATAGCACAAAGG + Intronic
1044777751 8:95710848-95710870 ATAGAACAGTAATAGCACGAAGG - Intergenic
1047551967 8:125883909-125883931 CTCTGACAATAATTGCATTAAGG + Intergenic
1048621786 8:136141600-136141622 CTCTAAAAGTAAGAGCACTGGGG + Intergenic
1052085282 9:24257704-24257726 CTTTAACAGTCATAGCATTTGGG - Intergenic
1052195181 9:25703954-25703976 CTGTAAAAGTAAGACCACTACGG + Intergenic
1053084331 9:35205051-35205073 CTATAACAAGAATAGCACCAAGG - Intronic
1053542925 9:38993555-38993577 CTCCAACAGTAATGGCAGTATGG + Intergenic
1053807368 9:41817072-41817094 CTCCAACAGTAATGGCAGTATGG + Intergenic
1054623224 9:67370355-67370377 CTCCAACAGTAATGGCAGTATGG - Intergenic
1057117354 9:92538517-92538539 CTCTTAAAGTAACAGCACTGAGG + Intronic
1059892859 9:118824114-118824136 CTCTAAGAGTAAGAGCAAGAGGG + Intergenic
1187708991 X:22035202-22035224 CTCTTACTGTAGAAGCACTAAGG - Intronic
1193231196 X:79048934-79048956 CCCTAATAGTAAAAGCAATATGG + Intergenic
1197410898 X:126115121-126115143 CTCTGACAGTTGTAGTACTAAGG - Intergenic