ID: 1153747641

View in Genome Browser
Species Human (GRCh38)
Location 18:8196379-8196401
Sequence GAGATGGGAACAGGAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1373
Summary {0: 1, 1: 0, 2: 6, 3: 130, 4: 1236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153747635_1153747641 13 Left 1153747635 18:8196343-8196365 CCTATACCTCTGTTCCTTAGTGC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1153747641 18:8196379-8196401 GAGATGGGAACAGGAGAGAGTGG 0: 1
1: 0
2: 6
3: 130
4: 1236
1153747636_1153747641 7 Left 1153747636 18:8196349-8196371 CCTCTGTTCCTTAGTGCTATTAC 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1153747641 18:8196379-8196401 GAGATGGGAACAGGAGAGAGTGG 0: 1
1: 0
2: 6
3: 130
4: 1236
1153747637_1153747641 -1 Left 1153747637 18:8196357-8196379 CCTTAGTGCTATTACTGTTAGAG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1153747641 18:8196379-8196401 GAGATGGGAACAGGAGAGAGTGG 0: 1
1: 0
2: 6
3: 130
4: 1236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153747641 Original CRISPR GAGATGGGAACAGGAGAGAG TGG Intronic
900377212 1:2360601-2360623 GAGCAGCGAAGAGGAGAGAGAGG + Intronic
900406727 1:2496070-2496092 GAGACGGCAATAGGAGGGAGTGG - Intronic
900580915 1:3408374-3408396 GAGAGGAGAACAGGACAGAGAGG + Intronic
900615622 1:3564517-3564539 GTGCTGGGCACAGGAGAGGGAGG - Intronic
900640891 1:3687629-3687651 GAGGGGAGAAAAGGAGAGAGAGG + Intronic
900703108 1:4060244-4060266 GAAAGGGAAACAGGAGAGAGAGG - Intergenic
900771976 1:4552516-4552538 GAACTGGCAACAGGAGGGAGAGG - Intergenic
900918249 1:5653222-5653244 GAGTTGGGGTCAGCAGAGAGCGG - Intergenic
901292462 1:8134819-8134841 TGGATGGGGACAGGAGAGTGGGG + Intergenic
901326244 1:8367121-8367143 GAGAGGGGAAAGTGAGAGAGGGG + Intronic
901826028 1:11861895-11861917 AGGATGGGAACAGGTCAGAGAGG + Intergenic
902367466 1:15986322-15986344 GAGAAGGGAAGGGAAGAGAGGGG - Intergenic
902378161 1:16039918-16039940 GAGCTGGGCACAGGGGAGAGAGG + Intergenic
902919495 1:19657627-19657649 GAGATGGGAAGTGGGGTGAGAGG - Exonic
902933884 1:19750564-19750586 AAGGAGGGAAGAGGAGAGAGAGG - Intronic
903301752 1:22384115-22384137 GAAATGGTAACAGAAGACAGAGG - Intergenic
903423333 1:23234500-23234522 AAGATGGGAACAATAGAGACTGG - Intergenic
903454332 1:23476711-23476733 GAGATGGGCAAAGGGAAGAGTGG - Intronic
903604610 1:24566505-24566527 GGGAAGGGAAGAGGAGACAGGGG + Intronic
904058103 1:27685695-27685717 GAGAGGGGGACGGCAGAGAGAGG - Intergenic
904294605 1:29510554-29510576 GAGATCTGAACAGGAGTAAGGGG + Intergenic
904603035 1:31684042-31684064 GAAAGGGGGACAGGAGGGAGAGG + Intronic
904756110 1:32769840-32769862 GAGGTGGGGTCAGCAGAGAGGGG - Intronic
904879968 1:33689017-33689039 GAGAGGAGAAAAAGAGAGAGAGG + Intronic
904945282 1:34194645-34194667 GAGGAGGGAAAAGAAGAGAGAGG - Intronic
905647648 1:39635528-39635550 GATATGGGAAGAGGAGAAGGGGG - Intronic
905889266 1:41509536-41509558 GAGGAGGCAACAGGAGAGTGAGG + Exonic
906376647 1:45301831-45301853 GAGATGGGAGCATGAGAAGGGGG + Intronic
906493255 1:46284718-46284740 GAGAAGGGAAAAGGAGAGTTTGG + Intronic
906653700 1:47533103-47533125 GAGAGAGGAAGAGGAGACAGCGG - Intergenic
906764152 1:48411115-48411137 GAGATGGGATGGGGAGAGAAGGG + Intronic
907269410 1:53282083-53282105 GAAATGGGAAGAGGAGAAACTGG - Intronic
907451599 1:54548978-54549000 GAGATGGGCTCAGGACAGACTGG + Intronic
907527150 1:55060425-55060447 GGTTTGGGAACAGGAGAGTGAGG + Intronic
907570938 1:55483100-55483122 GAGAAGTGAAGAGAAGAGAGGGG + Intergenic
907676458 1:56521901-56521923 GAGTTGGGGACCGGAGGGAGGGG + Intronic
908005761 1:59727036-59727058 TAGAGGGGGACAGGAGGGAGGGG - Intronic
908227632 1:62071974-62071996 AAGCAGGGAACAGGAGAGACTGG - Intronic
908395453 1:63721299-63721321 GAGAAGGGTAGAGGAGAGGGAGG - Intergenic
908488315 1:64617361-64617383 TAGATAGGAAGAAGAGAGAGTGG + Intronic
908628995 1:66080926-66080948 GAGATGGGAACAGCAGACACTGG - Intronic
908656108 1:66390597-66390619 GAGTTGGGAAGAAGAGAGGGTGG - Intergenic
908846950 1:68334298-68334320 AAGATGGGAACAAGAGACATTGG - Intergenic
909075805 1:71048575-71048597 GAGAGGGGAGCAGAAGAGAAAGG + Intergenic
909096367 1:71293215-71293237 AAGGTGAGAACAGGAGTGAGAGG - Intergenic
909149688 1:71986495-71986517 AAGATGGGAGCAGGACTGAGTGG - Intronic
909607798 1:77523976-77523998 GAGCTGGGGAAAGGAGGGAGAGG - Intronic
909732629 1:78913590-78913612 AAGATGGGAACAGCAGACATTGG + Intronic
910245592 1:85135055-85135077 GGGATGGGACCAGGTGACAGTGG - Intergenic
910365994 1:86466130-86466152 GACTTGGGAACGGGAGAGAATGG + Intergenic
911101022 1:94095870-94095892 GAGACGGAAGCAGGAGTGAGAGG + Intronic
911401882 1:97385666-97385688 GAGAGGGGAGCTGGAGAGGGAGG - Intronic
911647371 1:100351609-100351631 GCGGAGGGAACAGGAGAGAGAGG - Intergenic
911779427 1:101857594-101857616 GAGAAGGGGAAAGGAGAGGGGGG - Intronic
911805493 1:102201537-102201559 GAGTAGGGACCAAGAGAGAGAGG + Intergenic
912314464 1:108654420-108654442 GAGGGGTGAACAGGAGAGGGAGG + Intronic
912515692 1:110215318-110215340 GAGCTGGGAACAGGTACGAGGGG + Intronic
912661914 1:111539273-111539295 GAGATGGGAACAACAGACACTGG - Intronic
912682446 1:111738210-111738232 GAGATGGGCAAAGCAGAGATGGG + Intronic
912692545 1:111815275-111815297 GAGAAAGGAAAAGAAGAGAGGGG - Intronic
912715968 1:111983737-111983759 GAGTGGGGACCAGGTGAGAGAGG - Intronic
912876424 1:113364545-113364567 GAATTGGAAACAGGAGAGAAGGG + Intergenic
913701885 1:121382190-121382212 TAGATGGGAGAAGGAGAGAATGG - Intronic
914042444 1:144062659-144062681 TAGATGGGAGAAGGAGAGAATGG - Intergenic
914135644 1:144897829-144897851 TAGATGGGAGAAGGAGAGAATGG + Intronic
915073589 1:153292085-153292107 GAGCTGAGCACTGGAGAGAGAGG + Intergenic
915115885 1:153599229-153599251 GAGTTGGAAACTGGTGAGAGAGG - Intergenic
915310100 1:155002314-155002336 GAGATAGGGGCAGGAGAAAGGGG + Intergenic
915364766 1:155308953-155308975 TATCTGGGAACAGGTGAGAGAGG + Exonic
916023310 1:160813530-160813552 GAGTTGGGGGCAGCAGAGAGAGG - Intronic
916166383 1:161970309-161970331 GAGCCGGGAGAAGGAGAGAGGGG + Intergenic
916197305 1:162236600-162236622 AAAATGGAAAGAGGAGAGAGGGG - Intronic
916393101 1:164354398-164354420 GAGAGGGGAAGAGAAGGGAGGGG + Intergenic
916701465 1:167300235-167300257 AAGATGGGAACAGCAGACACTGG + Intronic
917139889 1:171825277-171825299 AAAGTGGGAACAGGAGAGTGGGG + Intergenic
917256339 1:173120639-173120661 GAGATGGGATGAGGTGGGAGTGG - Intergenic
917404027 1:174684321-174684343 GAGATTGGAGAAGGTGAGAGGGG + Intronic
917490840 1:175497207-175497229 GTGAAGGGAAGAGGAAAGAGAGG - Intronic
917621091 1:176796801-176796823 GAGAAAGAAAGAGGAGAGAGAGG - Intronic
917629383 1:176877820-176877842 GAGAGGTGAAAAGGAGAGAGAGG + Intronic
917678240 1:177340464-177340486 GAGATGGGGGCAGAGGAGAGAGG + Intergenic
918046968 1:180947455-180947477 GAGATGGGGAGAGGGGAGAGGGG + Exonic
918066230 1:181103887-181103909 GAGGTGGGAACAGGACTGAAGGG - Intergenic
918514618 1:185349295-185349317 GAAAAGGGAAGAGGAGAGAGAGG - Intergenic
919614274 1:199785739-199785761 GAGATGGGGATTGGAGGGAGAGG + Intergenic
919813976 1:201426330-201426352 GAGATGGGCATCGGTGAGAGGGG + Intronic
919854539 1:201696196-201696218 AGGATGGGAGCAGGAGAGGGTGG + Intronic
919900167 1:202038276-202038298 ACGTTGGGAACAGGAGAAAGAGG - Intergenic
919907527 1:202088179-202088201 AAGATGGGAACAAGTGAAAGGGG + Intergenic
920435363 1:205943579-205943601 GAGATAGGAAAAGGAGATAAGGG + Intergenic
920489308 1:206400910-206400932 TAGATGGGAGAAGGAGAGAATGG - Intronic
920561168 1:206939463-206939485 GCTGTGGGAACAGAAGAGAGAGG + Exonic
920839119 1:209539025-209539047 GAGCTCAGCACAGGAGAGAGAGG - Intergenic
920844539 1:209582990-209583012 GAGATGAGTACAGGAAACAGAGG + Intergenic
920939738 1:210470413-210470435 GAGATGGGACTATGAGAGAGGGG - Intronic
921277064 1:213531174-213531196 GAGATGGAAACAGGAGAGGAGGG - Intergenic
921538133 1:216377942-216377964 GAGAGAGGAACAGGGGAGGGAGG + Intronic
921765840 1:218972099-218972121 CACATGGCAGCAGGAGAGAGAGG - Intergenic
921771934 1:219050607-219050629 GAGAAGGGAAGGGGAGAAAGGGG + Intergenic
922027814 1:221768213-221768235 AAGATGGGAACAGTAGACACTGG - Intergenic
922370644 1:224907360-224907382 GAGCTGAGACCAGGAGAGTGGGG - Intronic
922474906 1:225899962-225899984 GAGATGGGAACAGGTGGCAGTGG - Intronic
922559051 1:226554788-226554810 GAAATGGGCACAGGTCAGAGGGG - Intronic
922617638 1:226972261-226972283 GAGAGAGGAAAAGGGGAGAGAGG + Intronic
922648137 1:227311842-227311864 TAGATGGGAAGAGGAGACATGGG - Intronic
922724045 1:227914409-227914431 GAGGAGGGGAGAGGAGAGAGAGG - Intergenic
923036397 1:230287835-230287857 GAGAGGGGGACGGCAGAGAGAGG + Intergenic
923040055 1:230313229-230313251 GAGAAGGGAAGAAGAGAGGGAGG + Intergenic
923082150 1:230668254-230668276 GAGAAGGGGAAAGGGGAGAGGGG + Intronic
923419194 1:233795930-233795952 AAGAAGGGAGCAAGAGAGAGGGG + Intergenic
923516694 1:234703717-234703739 GAGCTGGGAACAGTGAAGAGGGG + Intergenic
923776945 1:236987257-236987279 GAGCTGGGAATAGGGGAGAATGG - Intergenic
923857260 1:237858535-237858557 GGGAGGGAAACAGGAGAGAGAGG - Intergenic
923990716 1:239434106-239434128 GAGATGGGAATTGGAAGGAGTGG - Intronic
924228243 1:241940954-241940976 GACATGAGAACATGAGAGATGGG - Intergenic
924421814 1:243917070-243917092 GAGAATGGAAAAGGAGAGAAGGG + Intergenic
924498814 1:244616556-244616578 CAGAAGGCAAAAGGAGAGAGAGG + Intronic
924519478 1:244793928-244793950 GAGATGGGAACTGGGGAGGCAGG + Intergenic
924737635 1:246772545-246772567 AAAATGGGAACAGCAGAGAGTGG + Intergenic
924871487 1:248051551-248051573 AAGATGGGAACAGTAGACACTGG + Intronic
1062812648 10:478027-478049 GGGAGGGGAAAAGGAGAGAGGGG + Intronic
1062824892 10:559969-559991 GAGAGGAGAACAGGAGTGGGGGG - Intronic
1063154532 10:3366651-3366673 GGGATGAGGACAGGAAAGAGGGG - Intergenic
1063691643 10:8293089-8293111 GAAAAGGGAGCAGGAGAAAGAGG + Intergenic
1063877885 10:10498883-10498905 GAGTTGGAGACAGGAGAAAGGGG + Intergenic
1064332868 10:14410202-14410224 GAGAAGAGAACAGAAGAGAAAGG + Intronic
1064392594 10:14954481-14954503 AAATTGGGAACAGAAGAGAGAGG - Intergenic
1064547537 10:16465847-16465869 TACATGGCAGCAGGAGAGAGAGG + Intronic
1064570386 10:16686698-16686720 GAGAAGGGAACAGGGGAAAGAGG + Intronic
1064717389 10:18190753-18190775 GTGATGGGAAGTGGAGAGATGGG + Intronic
1064865698 10:19877180-19877202 GAGATAGAATGAGGAGAGAGAGG + Intronic
1064882674 10:20073963-20073985 GAGATGGGAGCATGTGAGATGGG + Intronic
1065233100 10:23619422-23619444 AAGAGGGGAACAGAAAAGAGTGG - Intergenic
1065660218 10:27998682-27998704 GAAAGGGGAGCAGGCGAGAGCGG + Intronic
1065664674 10:28045369-28045391 GAGGTGGGGAGAGGAGAGAGAGG - Intergenic
1065868067 10:29931215-29931237 GAGATGGGAATAAGAGTGGGAGG - Intergenic
1065973277 10:30821991-30822013 GAGAGGGGGCCAGGAGAGAGGGG + Intronic
1066106155 10:32159121-32159143 GAGATGGGAAGAGGTGAATGTGG + Intergenic
1066490998 10:35894703-35894725 GAGATGGGAACAACAGACACTGG + Intergenic
1067228549 10:44390957-44390979 GCAAGGGGAATAGGAGAGAGGGG - Intergenic
1067441561 10:46311668-46311690 GAGAAGGGCACAGTGGAGAGGGG + Intronic
1068056330 10:52016304-52016326 TATATGGCAGCAGGAGAGAGAGG + Intronic
1068101038 10:52553567-52553589 GAGATGGGAACAGGTGAAACGGG - Intergenic
1068254753 10:54494989-54495011 GAGCTGGGGAGAGGAGAGAATGG - Intronic
1068800188 10:61131803-61131825 AAGAAAGTAACAGGAGAGAGGGG - Intergenic
1069227404 10:65960694-65960716 AAGATGGGAACAGTAGATACTGG - Intronic
1069705816 10:70458617-70458639 GTGCGGGGAACAGGGGAGAGGGG - Intergenic
1069723169 10:70562251-70562273 GAGATGGGGACAGGGGTGAAAGG - Intronic
1069806222 10:71126697-71126719 GAGATGGGAACAGAAGGGTCGGG - Intergenic
1069818879 10:71215446-71215468 GGGTGGGGAAAAGGAGAGAGAGG - Intronic
1070156896 10:73840931-73840953 CAGATGGGAACAGGGAAGCGTGG - Intronic
1070574914 10:77670543-77670565 GAGAGAGGAAAGGGAGAGAGAGG + Intergenic
1070769121 10:79071990-79072012 GAGAAGGGAGCAGTAGGGAGTGG + Intronic
1071196232 10:83163512-83163534 TAGATGGCCACAGTAGAGAGAGG + Intergenic
1071718533 10:88120278-88120300 GAGAGGGGAACAGGAAGGAGGGG + Intergenic
1071814971 10:89223341-89223363 AAGATGGGAACAATAGACAGTGG - Intronic
1071929120 10:90446016-90446038 TAGAGGGGAACAGGAGACACTGG - Intergenic
1072425217 10:95324378-95324400 GGGAGGTGAACAGGAGAGGGTGG - Intronic
1072452335 10:95548354-95548376 GAGAAGGGGACAGAAGATAGTGG - Intronic
1072531165 10:96320827-96320849 TAGGTGGGAACGGGGGAGAGAGG + Intronic
1072537535 10:96374880-96374902 GAGATGGGATAAGGTGAGCGGGG + Intronic
1072729701 10:97837428-97837450 GGGCTGGACACAGGAGAGAGAGG + Intergenic
1073076755 10:100829234-100829256 GAGAAGCGGAGAGGAGAGAGGGG - Exonic
1073111350 10:101064782-101064804 GAAGAGAGAACAGGAGAGAGGGG - Intronic
1073113015 10:101073836-101073858 GAGATGGGGAGAGGGGAGAGGGG + Intergenic
1073184230 10:101606053-101606075 GAGGTGGGAATGGGGGAGAGCGG + Intronic
1073802492 10:107057591-107057613 GAGAGGACAACAGAAGAGAGAGG - Intronic
1074335637 10:112571950-112571972 AAGATGGGAACAGCAGACACTGG + Intronic
1074365763 10:112856324-112856346 GAGGTGGGAAATGGACAGAGAGG - Intergenic
1074544882 10:114394613-114394635 GAGAGGGGAAGAAGAGAGGGAGG + Intronic
1074889818 10:117726152-117726174 GGGCTGGGAAAAGGAGAGAAAGG - Intergenic
1075161396 10:120027807-120027829 GAGATGGGATGATGAGAGAGAGG + Intergenic
1075173830 10:120141136-120141158 GAGGAGGGAAGAGAAGAGAGTGG - Intergenic
1075363065 10:121857289-121857311 AAGATGGGAACAGTAGACAGTGG - Intronic
1075647917 10:124108601-124108623 GAGAGGGGAGCAAGAGAGAGGGG - Intergenic
1075724746 10:124605503-124605525 GAGATGGGGACAGGTGAGTGGGG + Intronic
1075845564 10:125542517-125542539 GAGATGGGCCAAGGAGAGATGGG + Intergenic
1075980199 10:126731810-126731832 CAGATGGGAACATGAGAAAGGGG + Intergenic
1076462362 10:130655954-130655976 GAGATGGGGCCAGAGGAGAGGGG - Intergenic
1076597585 10:131634894-131634916 AAGATGGGAACAGCAGACACTGG + Intergenic
1076609545 10:131713479-131713501 GAGCTGGGAACAGGAGGATGTGG - Intergenic
1077042987 11:532767-532789 GGGATGGGATCAGGAGGGACCGG + Intronic
1077173806 11:1179887-1179909 AAGATGGGGACAGGGGAGGGTGG - Intronic
1077213684 11:1385436-1385458 GAAGTGGGAGCAAGAGAGAGTGG + Intergenic
1077719751 11:4616083-4616105 GAGAAGGGAGGGGGAGAGAGGGG - Intergenic
1077762547 11:5118974-5118996 GAGAAGAGAAGAGAAGAGAGAGG + Intergenic
1077832694 11:5892005-5892027 AAGATGGGAACAGCAGACACTGG - Intronic
1078011526 11:7576406-7576428 GAGATGGGAATAGGAGGAGGTGG + Intronic
1078293486 11:10040746-10040768 GAGATGGGGAGAGGAGAGAGGGG + Intronic
1078345197 11:10541441-10541463 GAGATGGCACCAGGAGAGATGGG - Intergenic
1078444788 11:11395977-11395999 GAGATGGGGAGGGGAGAGGGAGG + Intronic
1078576393 11:12506515-12506537 AAAATGTGAGCAGGAGAGAGGGG + Intronic
1078787390 11:14508313-14508335 GACATAGGTACAGGAAAGAGTGG - Intronic
1078867366 11:15310532-15310554 AAGAGGAAAACAGGAGAGAGAGG - Intergenic
1078908078 11:15705900-15705922 GAGAAGGGAAGGGGAGAGAAGGG + Intergenic
1079277743 11:19057444-19057466 AATTTGGGAAAAGGAGAGAGAGG + Intronic
1079331953 11:19540915-19540937 GAGAAGGGAAAAGGAGGGAAGGG + Intronic
1079360346 11:19765620-19765642 AAGATGTGAGCAGGAGAGAAGGG - Intronic
1079600839 11:22312055-22312077 GAGAGAGAAAGAGGAGAGAGTGG + Intergenic
1079934575 11:26600659-26600681 GCAATGGGAAAAGGAGAGAAAGG - Intronic
1079968075 11:27003294-27003316 GAGGAGAGAACAGGAGAGAAGGG - Intergenic
1079999333 11:27329527-27329549 AAGATGGGAACAGTAGACACTGG - Intergenic
1080091970 11:28359107-28359129 AAGATGGGAACAAGAGACACTGG - Intergenic
1080460654 11:32451842-32451864 GAGGAGGGAAGAGGAGTGAGTGG + Intergenic
1080460659 11:32451879-32451901 CAGAGAGGAACTGGAGAGAGTGG + Intergenic
1080493682 11:32795077-32795099 TGGATGGGAACGGGAGAGAGAGG + Intergenic
1080745850 11:35108076-35108098 TCCATGGCAACAGGAGAGAGGGG - Intergenic
1080836814 11:35947041-35947063 GAGATGGGAGTAGGAGAGGGTGG + Intronic
1081106364 11:39075019-39075041 GAGGGGGGAGAAGGAGAGAGAGG - Intergenic
1081286679 11:41279004-41279026 AAGATGGGAACAGTAGATACTGG - Intronic
1081312813 11:41593999-41594021 GAGCTGGGAAGAGGATGGAGTGG + Intergenic
1081651265 11:44825617-44825639 GAGCTGGAAACAGGAGTCAGGGG + Intronic
1081694110 11:45097785-45097807 GAGATGTGGACTGAAGAGAGTGG - Intronic
1082001136 11:47394342-47394364 GAGAGGGGAACAGGCGAGGCCGG - Intergenic
1082108940 11:48251653-48251675 AAGATGGGAACAGTAGACACTGG - Intergenic
1082700715 11:56426749-56426771 CAGATGGGATGAGGAGAGAGAGG + Intergenic
1082783743 11:57305113-57305135 GGCATGGGAGCAGGAAAGAGGGG + Intronic
1083285833 11:61658267-61658289 GAATTGGGAACAGCAGAGGGGGG - Intergenic
1084563574 11:69917456-69917478 GAGAGGAGAAAGGGAGAGAGAGG - Intergenic
1084839679 11:71835261-71835283 AAAATGGGAACAAGAGAGATTGG - Intronic
1085443515 11:76583324-76583346 GAGATGGGAGAGGGAGAGAGAGG + Intergenic
1086111581 11:83204448-83204470 GAGATGGGAACAATAGACACTGG + Intronic
1086537903 11:87870753-87870775 GGGATTGGAAGAGGAAAGAGGGG + Intergenic
1086938745 11:92772510-92772532 AAGATAGGATAAGGAGAGAGGGG - Intronic
1087629538 11:100634493-100634515 GTGTTGGGGACAGGAGACAGTGG + Intergenic
1087946427 11:104165072-104165094 GAAAGGGCAACAGGACAGAGTGG + Intergenic
1087954000 11:104261034-104261056 GAGCTGGAAAAAGGAGAGAATGG - Intergenic
1088760199 11:112922321-112922343 GAGTGGGGAACTGGGGAGAGAGG + Intergenic
1088827146 11:113505656-113505678 GAGACAGGGACAGGACAGAGAGG - Intergenic
1088927489 11:114317097-114317119 AAGATGGGAACAATAGACAGTGG + Intergenic
1089031077 11:115330010-115330032 TATATGGGTACAGGATAGAGGGG + Intronic
1089352736 11:117830661-117830683 AAGATGGGGACAGGATAGAGGGG + Intronic
1089397933 11:118147989-118148011 AAGATGGGTCCAGAAGAGAGGGG + Intronic
1089459536 11:118644582-118644604 GAGGGGGTAAGAGGAGAGAGAGG - Intronic
1089602358 11:119623757-119623779 GAGAGAGGAAGAGGGGAGAGTGG + Intronic
1089672673 11:120067391-120067413 GAGCTGGCAAGAGGAGAGAGTGG + Intergenic
1089706757 11:120283651-120283673 GAGATGGGAAGTGGGGAGAAGGG - Intronic
1089997073 11:122918567-122918589 AAGATGGGAACAAGGGAGAGTGG + Intronic
1090046797 11:123342795-123342817 TAGATGGGATCATGAGAGTGGGG + Intergenic
1090048605 11:123358251-123358273 GAGACGGAGAGAGGAGAGAGGGG + Intergenic
1090082123 11:123620669-123620691 GAGAAGGGAACACGAGGGTGAGG + Intronic
1090460085 11:126883383-126883405 GAGAGGGATGCAGGAGAGAGAGG - Intronic
1090895180 11:130965411-130965433 AAGATGGGAACAGTAGACACAGG - Intergenic
1091078053 11:132639737-132639759 GAGCTGGTAAAAGAAGAGAGGGG + Intronic
1091282004 11:134387194-134387216 GAGGTGGGAAGTGGAGGGAGTGG - Intronic
1091386750 12:100835-100857 GAGAAGGAAAGAGGAGAGCGTGG + Intronic
1091813654 12:3419981-3420003 GAGAGGGGGAGAGGGGAGAGGGG + Intronic
1091929821 12:4386665-4386687 GAGATGGGAACAACAGACACTGG + Intergenic
1092001817 12:5038993-5039015 GAGATGGAAGCAGGAGGGGGAGG - Intergenic
1092491141 12:8946435-8946457 CAGGTAGGATCAGGAGAGAGAGG + Intronic
1092807151 12:12235008-12235030 GAGATGGGACTAGGATAGAAGGG + Intronic
1093094546 12:14957881-14957903 GAGAAGGGAGAAAGAGAGAGAGG + Intronic
1093262064 12:16950625-16950647 GAGGTGGGGAGAGGAGAGTGGGG - Intergenic
1093283287 12:17223708-17223730 GAGAGAGGAAAAAGAGAGAGAGG + Intergenic
1093294529 12:17371857-17371879 GAGATGAGAAAGAGAGAGAGAGG - Intergenic
1093313323 12:17618240-17618262 GAATTGGTACCAGGAGAGAGTGG - Intergenic
1093524293 12:20089850-20089872 GAGATGGAAACAGTAGACACTGG + Intergenic
1093534827 12:20210300-20210322 GGGAAGGGAAGGGGAGAGAGGGG - Intergenic
1093720242 12:22433559-22433581 GAGGTAGGAAGAGGAGTGAGGGG + Intronic
1093759462 12:22891143-22891165 AAGATGGGAACAGTAGACACTGG - Intergenic
1093875910 12:24349222-24349244 CAGAGGGGAACTGGGGAGAGGGG - Intergenic
1094142572 12:27196035-27196057 GAGAGGGAAACGGGACAGAGTGG - Intergenic
1094592876 12:31837775-31837797 GAGATGGCAGCACAAGAGAGAGG + Intergenic
1095396844 12:41771651-41771673 AAGGTGGGAAGAGGAGAGAAGGG + Intergenic
1096418752 12:51437511-51437533 AAGATGGGGGCAAGAGAGAGGGG - Intronic
1096421778 12:51464858-51464880 GAGACAGAAACAGGAGAGAATGG + Intronic
1096615756 12:52832652-52832674 GAGATGGGACCTGGAGATATTGG - Intronic
1096665882 12:53164545-53164567 AAGATGGGAACAAAAGACAGTGG + Intronic
1096775235 12:53959697-53959719 GAAAAGGTAACTGGAGAGAGGGG - Intergenic
1096878508 12:54648577-54648599 GAGATGGGAAGGGGAGAGGCAGG - Intergenic
1096905242 12:54929769-54929791 AAGATGGCAAGAGGAGAGGGAGG + Intergenic
1097009335 12:55941123-55941145 GGGAGGGAAACAGGAGGGAGGGG + Intronic
1097088376 12:56486435-56486457 GAGACTAGAACAGGAGGGAGAGG + Intronic
1097172482 12:57124994-57125016 AAGTTTGGAACAGGAGAGATAGG + Intronic
1097321795 12:58233804-58233826 GACAAGAGAAAAGGAGAGAGTGG + Intergenic
1097400972 12:59127282-59127304 TACATGGCAGCAGGAGAGAGAGG + Intergenic
1097839080 12:64303414-64303436 GAGATGGGAAGAGAGGGGAGTGG - Intronic
1097891526 12:64781515-64781537 GAGATGGGAGGAGGGAAGAGCGG - Intronic
1097974484 12:65669978-65670000 AAGATGGGAACAGGAGACACTGG + Intergenic
1098006391 12:66001037-66001059 AAGCTGGGAACAGGAGAAAGAGG - Intergenic
1098236750 12:68424868-68424890 AAGGTGAGAACAGGAGAGCGGGG - Intergenic
1098387681 12:69935982-69936004 CAGATGGGAGCAGGGGGGAGGGG - Intronic
1098738322 12:74136709-74136731 AAGATGGGAACAAGAGATACTGG - Intergenic
1099678729 12:85795830-85795852 GTGATGGAAACAGGAAAGAGAGG + Intergenic
1099842287 12:87981255-87981277 GGAATTGGAACAGGAGAGAATGG + Intronic
1100159556 12:91842655-91842677 TACATGGCAGCAGGAGAGAGAGG - Intergenic
1100915088 12:99411226-99411248 AAGATGGGAACAGTAGACACTGG - Intronic
1101067313 12:101035819-101035841 AAGAAGGGAACAGGAGACACTGG + Intronic
1101211361 12:102538244-102538266 GAGGTGGGAGAAGGATAGAGGGG + Intergenic
1101408247 12:104447743-104447765 AAGATGGGAACAGTAGACACTGG - Intergenic
1101613782 12:106316379-106316401 GAGATGGGGTCAGGGGAGTGGGG - Intronic
1101646449 12:106634902-106634924 GAGAAAGGCAGAGGAGAGAGAGG - Intronic
1101652860 12:106693606-106693628 GAGCTGGGATCAGGGGACAGTGG + Intronic
1102007636 12:109598587-109598609 GAGATGGGTGCAGGGGACAGAGG + Intergenic
1102391389 12:112551734-112551756 GAGATGGGCAAGGAAGAGAGAGG + Intergenic
1102434654 12:112911356-112911378 GGGATGGAAAAAGGAGAGAAAGG + Intronic
1102535113 12:113575591-113575613 GAAAAGGGAGCAGGAGAGAGTGG + Intergenic
1102707545 12:114895457-114895479 GCCAAGGGAACAGGAGAGAAGGG - Intergenic
1102744964 12:115242432-115242454 GAGAGGGTAAGAGGAGGGAGTGG - Intergenic
1102878966 12:116469703-116469725 AAGATGGGAACAGTAGACACTGG + Intergenic
1103555647 12:121764772-121764794 GAGATGGGAGCAGCACTGAGTGG + Intronic
1103582805 12:121928378-121928400 CAGATGGAAACAGGAGAGGATGG + Intronic
1103608429 12:122105832-122105854 AAGAAGGGAACAAGAGAGAGAGG - Intronic
1104499759 12:129273734-129273756 AAGATGGGAACAGTAGATACTGG + Intronic
1104604916 12:130180772-130180794 GAGATGAGGCCAGGAGAGTGGGG - Intergenic
1104719067 12:131034567-131034589 GAGAGAAGAGCAGGAGAGAGAGG + Intronic
1104727962 12:131089189-131089211 GAGGGGGGAACTGGAGAGACAGG + Intronic
1105332635 13:19432209-19432231 GCAATGAGAACAGGAGAGATGGG + Intronic
1105582030 13:21707094-21707116 GAGATGGAAACTGCAGCGAGGGG - Intergenic
1105584326 13:21730153-21730175 GAGATGGGAAGGGGAGAATGGGG - Intergenic
1105879051 13:24587568-24587590 GCAATGAGAACAGGAGAGATGGG - Intergenic
1105920787 13:24961484-24961506 GCAATGAGAACAGGAGAGATGGG + Intergenic
1105976385 13:25477270-25477292 AATTTGGGAAGAGGAGAGAGGGG - Intronic
1106531272 13:30594402-30594424 AAGATGGGAACAGTAGACACTGG - Intronic
1106538100 13:30665720-30665742 CAGATGGGACAAGGAGATAGAGG + Intergenic
1107015094 13:35701951-35701973 CAGAGGGGAACAGGAGAGGATGG - Intergenic
1107108013 13:36667572-36667594 GAGATGGGACCAGGCTAAAGTGG - Intergenic
1107328383 13:39269977-39269999 AAGATGGGAACAGTAGATACTGG + Intergenic
1107566548 13:41611084-41611106 GAGATGGGAAGAGAAGAGCTAGG - Intronic
1107585685 13:41845798-41845820 GAGATGGGAACAATAGACAATGG + Intronic
1107600992 13:42012241-42012263 GAGAAGGGAGCAGGGGACAGAGG - Intergenic
1107799241 13:44088572-44088594 GAGAGGGAAGCAAGAGAGAGAGG - Intergenic
1108057605 13:46499963-46499985 GAGATGGAAACGTGAGAGAGGGG - Intergenic
1108327004 13:49343589-49343611 GAGAAGGGGAGAGGAGGGAGAGG + Intronic
1108437341 13:50413653-50413675 GAGAGGGGAATAGGAAAGAAGGG + Intronic
1108579570 13:51817209-51817231 GAGAGAGAAAGAGGAGAGAGAGG + Intergenic
1109291052 13:60475264-60475286 GAGATGGGAACAAGAGACACTGG - Intronic
1109643821 13:65226082-65226104 GAAGTGAGAAAAGGAGAGAGAGG + Intergenic
1109932055 13:69228774-69228796 GAGATGGGAACATTAGACACTGG - Intergenic
1110073631 13:71210846-71210868 GATATGAGATCAGGAGAGAAAGG - Intergenic
1110153929 13:72290875-72290897 GAGATGGGAAAATGGGAGACAGG - Intergenic
1110189712 13:72716288-72716310 GAGAGGAGAGCAAGAGAGAGGGG + Intronic
1110282359 13:73709778-73709800 GAGCTGGAAACAGGAGAGCTAGG + Intronic
1110324442 13:74198145-74198167 GAGAAAGCAAGAGGAGAGAGTGG + Intergenic
1110840541 13:80137000-80137022 TGGAAGGGAACAGGAGAGAAGGG + Intergenic
1111047605 13:82835162-82835184 GAGGTGGGAAGAGGAAGGAGTGG + Intergenic
1111117334 13:83796584-83796606 TATATGGGCACAGGATAGAGGGG + Intergenic
1111607515 13:90560435-90560457 GAGAAGGGAGCAAAAGAGAGAGG + Intergenic
1111768419 13:92564698-92564720 AAGATGGGAACAATAGACAGTGG - Intronic
1111878156 13:93921695-93921717 TATATGGGTACAGGATAGAGGGG + Intronic
1112127083 13:96479945-96479967 GAGATGGGAGCAGAATATAGTGG - Intronic
1112554167 13:100451683-100451705 AGGAGGGGAAGAGGAGAGAGAGG - Intronic
1112554203 13:100451917-100451939 GAGAGAGGGAGAGGAGAGAGAGG - Intronic
1112554206 13:100451932-100451954 GAGAGAGGGAGAGGAGAGAGAGG - Intronic
1112554209 13:100451947-100451969 GAGAGAGGGAGAGGAGAGAGAGG - Intronic
1112554212 13:100451962-100451984 GAGAGAGGGAGAGGAGAGAGAGG - Intronic
1112766275 13:102747951-102747973 TAGAAAGGAACAGGAGAAAGAGG - Exonic
1113110881 13:106822347-106822369 GAGAGGGGAAAAGGAGACAAAGG - Intergenic
1113380873 13:109804758-109804780 GAGATGGCACCAGGAGACAGTGG - Intergenic
1113636278 13:111921008-111921030 GAGAGAGGAAGAGGAGAGAGAGG + Intergenic
1113730677 13:112638997-112639019 CTGAAGGGAACAGGAAAGAGGGG - Intergenic
1113931248 13:113970097-113970119 GAGGTGGACACAGGAGAGGGTGG - Intergenic
1113936609 13:113998237-113998259 GAGATGGGAAGAGGAGGGTGTGG - Intronic
1114273264 14:21118063-21118085 GAGCTGGGGAAAGGAGAGAGTGG + Intergenic
1114524280 14:23358829-23358851 GAGAAGGGGACAGGGGAGGGAGG - Intronic
1114532137 14:23402865-23402887 GAGTTGGGAAAGGGAGGGAGGGG + Intronic
1114549486 14:23524802-23524824 GAGAGGGGAAGAGGAGGAAGAGG - Exonic
1114683267 14:24505308-24505330 GAGAAGAGAGCAGCAGAGAGGGG + Intronic
1114702949 14:24697048-24697070 GTGATTGGAACATGAGTGAGTGG + Intergenic
1115267407 14:31514948-31514970 GATATGTGAAAGGGAGAGAGAGG - Intronic
1115498205 14:34027281-34027303 GAGAGGGGAGGAGGAGGGAGAGG + Intronic
1115546362 14:34468073-34468095 GAAAGTGGAAGAGGAGAGAGAGG - Intergenic
1115556091 14:34546226-34546248 GAGAGAGAGACAGGAGAGAGGGG - Intergenic
1115557817 14:34556855-34556877 GAGAGAGAGACAGGAGAGAGGGG + Intergenic
1115624082 14:35172523-35172545 GAGGAGAGGACAGGAGAGAGAGG - Intronic
1115724480 14:36198436-36198458 GAGATGGGAACAAAAGACACTGG + Intergenic
1115945375 14:38653964-38653986 AAGATGGTGACAGGAGATAGTGG - Intergenic
1116010047 14:39340968-39340990 GAGATGGTAGCTGGAGGGAGAGG + Intronic
1116020519 14:39454794-39454816 GAGAGGAGAAGAGGAGAGAGAGG + Intergenic
1116043164 14:39710695-39710717 AAGATGGGAACAATAGAGACAGG + Intergenic
1116319491 14:43442163-43442185 AAGATGGCAACAGGAGACACTGG - Intergenic
1116663748 14:47748161-47748183 GTGAAGGGAAAAGGAGAGAAGGG + Intergenic
1116664182 14:47754007-47754029 CACATGGCAGCAGGAGAGAGAGG + Intergenic
1116731511 14:48628396-48628418 GAGAGGGGGAGGGGAGAGAGGGG - Intergenic
1116756637 14:48957058-48957080 GAAGTGGGAAAAGGAGTGAGAGG + Intergenic
1117414337 14:55479897-55479919 AAGTTGGAAACTGGAGAGAGAGG + Intergenic
1117828937 14:59731791-59731813 GAGATGAGATCAGGAGAGCTAGG - Intronic
1118111989 14:62732226-62732248 GAGAGGGGAACAGATGGGAGAGG - Intronic
1118329031 14:64801525-64801547 GAGATGGGAGCAGAGGAGAGGGG + Intronic
1118458546 14:65966922-65966944 GTGATGGGAACAGGGGCGGGAGG + Intronic
1118470405 14:66069893-66069915 GAAATGAAAAGAGGAGAGAGTGG + Intergenic
1118609433 14:67528651-67528673 GGGATAGGGACAGGAGAGGGAGG - Intronic
1118884247 14:69853328-69853350 GAGATGGCAAAGGGAAAGAGTGG - Intergenic
1119079705 14:71680962-71680984 GAGCTGGGTAGAGGAGGGAGTGG - Intronic
1119426514 14:74538877-74538899 GAGATGGAAAGATGAGAGTGAGG + Intronic
1119466901 14:74865412-74865434 GGGTTGGAAACTGGAGAGAGCGG + Intronic
1119931463 14:78551682-78551704 GGGATGGGAAAAGGAGAAAGGGG - Intronic
1119958977 14:78833377-78833399 GAGATGACAACAGGAGACTGCGG - Intronic
1120252764 14:82079169-82079191 GAGATGAGAACAGTAGACATGGG - Intergenic
1120594165 14:86413636-86413658 GATATGGGTGCAGGAGAGCGGGG - Intergenic
1120827486 14:88968945-88968967 GAGAGGGGAACATGAGCGTGTGG - Intergenic
1120875530 14:89371734-89371756 GAGAGGGGAGGAGGAGAGTGAGG + Intronic
1120907108 14:89630366-89630388 GAGGGTGGAACAGGAGGGAGGGG - Intronic
1121187015 14:91982427-91982449 AAGATGGGAACAGCAGACACTGG + Intronic
1121233035 14:92372315-92372337 TAAATGGGAACAGGAGGGTGTGG + Intronic
1121355171 14:93207650-93207672 GAGTTGGAGACAGGGGAGAGGGG - Intronic
1121371968 14:93367230-93367252 GAAATGGGTACAGGAAATAGTGG + Intronic
1121486226 14:94317470-94317492 CACATCGGATCAGGAGAGAGAGG - Intronic
1121560827 14:94874024-94874046 CAGAGGGGAGCAGGAGAGAGTGG - Intergenic
1121576747 14:94995218-94995240 GAGATGGGCTCTGGAGTGAGGGG - Intergenic
1121592353 14:95125658-95125680 GAGATGGGGGGAGGAGGGAGGGG + Intronic
1122866204 14:104605096-104605118 GAAAGGAGACCAGGAGAGAGAGG + Intronic
1122885057 14:104707202-104707224 GAGAAGGGAGCCGGAGAGGGAGG - Intronic
1123123580 14:105929296-105929318 GTGCTGGGAACCAGAGAGAGGGG - Intronic
1123780118 15:23617974-23617996 AAGAGGGGAACAGCAGAGACTGG + Intronic
1124411905 15:29443720-29443742 AGGAGGGGAAAAGGAGAGAGGGG + Intronic
1124440220 15:29680299-29680321 GAGAGGGGAAAGGGAGGGAGAGG + Intergenic
1124812959 15:32960221-32960243 AACATGGCAGCAGGAGAGAGAGG + Intronic
1125019943 15:34974568-34974590 GAGATGAGAGCAAGAGGGAGGGG - Intergenic
1125484936 15:40105328-40105350 GAAAGGGGAACTGGAGAAAGAGG - Intronic
1125584907 15:40813303-40813325 GACATGGGAACAGGGGATGGGGG - Intronic
1125613737 15:40991410-40991432 GTGATGTGAACTGGAGGGAGTGG + Intronic
1126666527 15:51080530-51080552 GAGATGGACACAGGAGAGAAGGG - Intronic
1126672248 15:51126969-51126991 GAAATGGGGATAGGAGGGAGAGG + Intergenic
1126691145 15:51289805-51289827 GAGAGGGGAATGGGATAGAGAGG + Intronic
1127532828 15:59861886-59861908 GAGCTGGAAATGGGAGAGAGAGG + Intergenic
1127730738 15:61799998-61800020 GAGTGGTGAAAAGGAGAGAGAGG - Intergenic
1127767740 15:62203930-62203952 AAGATGGGAACAGTAGACACTGG - Intergenic
1127905355 15:63372279-63372301 GAGGTGGCATCATGAGAGAGAGG - Intronic
1128215305 15:65930451-65930473 GAGGTGGGACGTGGAGAGAGGGG - Intronic
1128617498 15:69121624-69121646 GAGAGGGGAAGAGGAGAAAGAGG - Intergenic
1128760189 15:70211348-70211370 GGGTTGGGAACAGGGGAGAGGGG + Intergenic
1129044974 15:72725966-72725988 GAGATGGGAAAAGGGGAAAGGGG - Intronic
1129255621 15:74332417-74332439 GAGAAGGGAGGAAGAGAGAGAGG + Intronic
1129265565 15:74391536-74391558 GAGAGGGGCCCAGAAGAGAGAGG - Intergenic
1129268717 15:74408494-74408516 GAGAAGGGAACAAGGGGGAGGGG + Intergenic
1129762973 15:78142274-78142296 GAGATGGGAACACAGGAGAGAGG + Intronic
1130067477 15:80616589-80616611 GAGTGGGGATCAGGGGAGAGGGG - Intergenic
1130169349 15:81495822-81495844 GAGATGGTGAGAGGAGAGTGAGG - Intergenic
1130229427 15:82085466-82085488 GAGATTGGAAGAGAAGAGAGAGG + Intergenic
1130305242 15:82709100-82709122 GAGATGGGGACCAGAGGGAGGGG + Intronic
1130788162 15:87123256-87123278 GAGAGGGGAGGAGGAGAGGGAGG - Intergenic
1130871096 15:87972954-87972976 GAGAAGGGAACAAGAAAGACAGG - Intronic
1131077180 15:89502637-89502659 GAGGTTGGGATAGGAGAGAGTGG - Intergenic
1131118752 15:89810046-89810068 GAGGTGGGAACTGGAGACTGGGG - Intronic
1131258253 15:90875548-90875570 AAGAGGGGAAAAGGGGAGAGAGG - Intronic
1131715512 15:95106359-95106381 GAGAGAGGAAGAAGAGAGAGAGG - Intergenic
1131732396 15:95295851-95295873 GAGAGAGAAATAGGAGAGAGGGG + Intergenic
1131909102 15:97177212-97177234 GAGAGGGGAACTGATGAGAGAGG - Intergenic
1131957957 15:97757848-97757870 GAGACTGAAGCAGGAGAGAGGGG - Intergenic
1132182166 15:99764741-99764763 AAGATGGGAACAATAGACAGTGG + Intergenic
1132249656 15:100325673-100325695 GAGAAGGGAGCAAGAGAGAAGGG - Intronic
1132904791 16:2277025-2277047 GAGCTGGGAACAGCACAGGGAGG - Intronic
1133148736 16:3810407-3810429 GAGCTAGCAACAGGAGAGATAGG - Intronic
1133482494 16:6184515-6184537 GAGATGTGAAAGAGAGAGAGGGG + Intronic
1133520642 16:6553215-6553237 GAGATGTGAACAGGCAAGAAGGG + Intronic
1133964271 16:10519476-10519498 GAGAGGGGAAGGGAAGAGAGGGG - Intergenic
1134094781 16:11412163-11412185 GAGTTAGCAACAGGGGAGAGAGG - Intronic
1134122825 16:11596773-11596795 GGGAGGGGGACAGGGGAGAGGGG + Intronic
1134396757 16:13872300-13872322 GAGTTGGGAAAAGGGGAGGGTGG - Intergenic
1134904978 16:17972355-17972377 GAGATGGGAGCAGGAGACGTGGG - Intergenic
1135192730 16:20368037-20368059 GAAATGGGATCAGGAGGGTGAGG + Intronic
1135681289 16:24459517-24459539 GGGAAGGGAAGAGGAGGGAGGGG + Intergenic
1135877723 16:26218850-26218872 GAGATGGGAACAATAGACAGTGG + Intergenic
1135879278 16:26238420-26238442 GAGAGGGCAAGAAGAGAGAGAGG + Intergenic
1136055272 16:27683677-27683699 GAGCTGGGAAAGGGAGAGAGAGG + Intronic
1136134827 16:28249448-28249470 GAGGAGGAACCAGGAGAGAGTGG - Intergenic
1136153179 16:28365383-28365405 GAGAGGATCACAGGAGAGAGAGG + Intergenic
1136209907 16:28749890-28749912 GAGAGGATCACAGGAGAGAGAGG - Intergenic
1136232490 16:28894797-28894819 GAGATGGGCAGAGGAGGAAGAGG - Intronic
1136361160 16:29780616-29780638 AAGATGGGAAGATGAGGGAGAGG + Exonic
1136632689 16:31498189-31498211 GAGAGGGGAACTCTAGAGAGGGG + Intronic
1137016950 16:35387050-35387072 GGAATGGGAACAGGAAAGATGGG + Intergenic
1137502107 16:49019526-49019548 GAGATGGGAAGGGGAGGGAAAGG + Intergenic
1137603078 16:49769712-49769734 GAGATGAGAGGGGGAGAGAGGGG - Intronic
1137668474 16:50265833-50265855 GAGAGGCTAAGAGGAGAGAGTGG - Intronic
1137704512 16:50525227-50525249 GAGATGGGAATGACAGAGAGAGG + Intergenic
1137705975 16:50536074-50536096 GAGAGGGGAACCGCACAGAGAGG + Intergenic
1137832614 16:51558348-51558370 GAGAAGGGCAGAAGAGAGAGGGG + Intergenic
1138405805 16:56793008-56793030 GGGATGGGGATAGGGGAGAGTGG + Intronic
1138622728 16:58224743-58224765 GAGAGGGAGATAGGAGAGAGGGG + Intergenic
1138624989 16:58244472-58244494 AAGATGGGAAAAGGAGACTGAGG - Intronic
1138988509 16:62361517-62361539 GGGAAGGGAAGGGGAGAGAGAGG + Intergenic
1139548572 16:67661143-67661165 GAGCTGGGAAGGGGAGAAAGAGG - Intronic
1140016404 16:71190968-71190990 GAGAGAGGAGCAGGAGAGAAGGG + Intronic
1140026745 16:71297677-71297699 GAGATGGAGAGAGGGGAGAGTGG - Intergenic
1140562783 16:76003108-76003130 AAGATGGGAACAACAGACAGTGG + Intergenic
1140724448 16:77799372-77799394 GAGAGAGAAAGAGGAGAGAGAGG - Intronic
1141046938 16:80723847-80723869 GAGTGAGGAACAGGAGAAAGAGG + Intronic
1141103717 16:81216146-81216168 GAGGCAGGAACAGGAGGGAGAGG + Intergenic
1141234311 16:82201260-82201282 GTGATGGGTAGAGGAGTGAGAGG - Intergenic
1141657209 16:85422613-85422635 GAGAAAGGGGCAGGAGAGAGGGG + Intergenic
1141674185 16:85509009-85509031 AAGGTGGGAACAGCAGGGAGAGG + Intergenic
1141689262 16:85587218-85587240 AAGATGAAAACAGGAAAGAGCGG + Intergenic
1142707476 17:1705302-1705324 GAGGTGGGAACAGAGAAGAGCGG - Exonic
1142904822 17:3034561-3034583 GAGAGGGGAACAGGATTGGGGGG - Exonic
1143007222 17:3845036-3845058 GAGATGGGGAGAGGGGAAAGGGG + Intronic
1143138383 17:4725425-4725447 AGGATGGGAGCAGGAGAGGGAGG - Intergenic
1143898440 17:10155362-10155384 GAGAAGGGAAGTGGAGGGAGAGG - Intronic
1144021888 17:11245207-11245229 GAGATGGGCACAGGATTGAAAGG + Intronic
1144407419 17:14965721-14965743 GAGCTGGAGACAGGTGAGAGAGG + Intergenic
1144422438 17:15110564-15110586 TAGAGGGCAAGAGGAGAGAGAGG - Intergenic
1144642120 17:16943443-16943465 GAGATTAGAACTGGAGGGAGAGG - Intronic
1144740898 17:17581701-17581723 GACCTGGGCACAGGAGGGAGAGG - Intronic
1144765026 17:17727857-17727879 GAGAAGGGAAGGAGAGAGAGAGG + Intronic
1144910153 17:18673903-18673925 GTGATGGATAAAGGAGAGAGGGG + Intronic
1144994888 17:19260719-19260741 GAGATGAGATCAGGAGTGAGGGG - Intronic
1145207028 17:20990024-20990046 GAGATTAGAACTGGAGGGAGAGG + Intergenic
1145747037 17:27327971-27327993 GTGATGGGAACAAGAGAGGTTGG - Intergenic
1145750596 17:27353053-27353075 GAGGTGGGGACAGGTGAGACTGG + Intergenic
1145988019 17:29060669-29060691 TAGATGAGCACAGGAAAGAGTGG + Intergenic
1146180764 17:30696994-30697016 GGGTTGGGAATAGGAGTGAGGGG - Intergenic
1146266726 17:31457844-31457866 GGGAGGGGAAAAGGAGAGAGAGG - Intronic
1146688996 17:34860157-34860179 CAGATGGGAACGGGAGGAAGAGG - Intergenic
1147121786 17:38339355-38339377 GTGATGGGAAAAGGGGAGGGAGG + Intronic
1147193116 17:38748493-38748515 GAGACGGGAAGAGGAGGGGGAGG + Intronic
1147325798 17:39668853-39668875 GAGAGGGGCAGAGGAGAGAGAGG + Intronic
1147386997 17:40088827-40088849 GAGATGGGACTGGGAGACAGAGG - Intronic
1147462428 17:40581928-40581950 GAGGTGGGGGCAGGAGTGAGAGG - Intergenic
1148021196 17:44555190-44555212 GAGCTGGAAACAGGAAATAGAGG - Intergenic
1148464695 17:47857876-47857898 GAGCTGAGATCAAGAGAGAGGGG - Intergenic
1148554467 17:48570052-48570074 GAGATTTGAACAGGAGAGGAGGG + Intronic
1148721672 17:49757859-49757881 GAAGTGGGAACAGGGAAGAGTGG - Intronic
1149057244 17:52380643-52380665 GTGATGGGAAGAGGAGAAAGAGG + Intergenic
1149069283 17:52520381-52520403 AAGATGGGAACAACAGACAGTGG - Intergenic
1149865519 17:60149173-60149195 GAGATGGGAAGAGAAGAGACTGG - Intergenic
1150243369 17:63654224-63654246 GAGCTGAGAAGAGGAGAGAAAGG - Intronic
1150825499 17:68471554-68471576 GAGGTGGGAAAAGAATAGAGGGG - Intergenic
1150888975 17:69122703-69122725 GAGGTGGGCACAAGAGAAAGAGG + Intronic
1150917732 17:69453547-69453569 GAGAGGTGAGCAGGAGAAAGAGG - Intronic
1150943344 17:69717473-69717495 GGGCTGGAAGCAGGAGAGAGAGG - Intergenic
1150943430 17:69718621-69718643 GAGATTGGAACAATGGAGAGGGG - Intergenic
1150982439 17:70157484-70157506 GAGATATGAGCAGGAGGGAGAGG + Intergenic
1151236534 17:72724176-72724198 GAGAAGGGGAGAGGAAAGAGAGG + Intronic
1151390606 17:73784475-73784497 GAGAAAGGAACTGGAGACAGGGG - Intergenic
1151421260 17:73999453-73999475 GAGAAGGGAACAGGAGGGCAGGG - Intergenic
1151431172 17:74064290-74064312 GAGAGGGGAACGAGAGAGAGGGG - Intergenic
1151441491 17:74132195-74132217 GAGGAAGGAAGAGGAGAGAGGGG + Intergenic
1151521143 17:74630610-74630632 GAGAAGGAAAGTGGAGAGAGAGG + Intergenic
1151553610 17:74835720-74835742 GAGGGGAGAACAGGACAGAGAGG + Intronic
1151778051 17:76222004-76222026 GGGATGGGGGCAGGGGAGAGTGG + Intronic
1151869254 17:76825484-76825506 GAGAGGGAGACAGGAGAGAGAGG - Intergenic
1152846902 17:82606244-82606266 GGAATGGGAACAGCACAGAGAGG + Intronic
1153047911 18:873265-873287 CAGATGGCAACAGCAGACAGTGG + Intergenic
1153135728 18:1915559-1915581 AAATTGGGAACAGGAGAGAAGGG + Intergenic
1153380684 18:4435855-4435877 TGGATGGGACCAGGAAAGAGAGG + Intronic
1153607209 18:6846645-6846667 GGAATGGGGACAGCAGAGAGGGG - Intronic
1153666312 18:7370194-7370216 GACAGGGGAAGAGGAGAGGGAGG - Intergenic
1153747641 18:8196379-8196401 GAGATGGGAACAGGAGAGAGTGG + Intronic
1153817675 18:8805283-8805305 GAGATGGGAACAACAGACACTGG - Intronic
1153953564 18:10076860-10076882 CAGAGGGGCACAGAAGAGAGAGG - Intergenic
1154007160 18:10541650-10541672 GAGATGAGAACAGAAGAGAAAGG - Intronic
1154055005 18:11004249-11004271 CAGAGAGGAACAGAAGAGAGAGG + Intronic
1154291703 18:13113943-13113965 CACATGGGCACATGAGAGAGAGG + Intronic
1155939694 18:31790976-31790998 GAGTGGGGGACAGGAGAGTGAGG + Intergenic
1155986302 18:32233963-32233985 TACATGGTAGCAGGAGAGAGAGG - Intronic
1156407544 18:36797131-36797153 GAGTTGGGAACAGGAGGCAGAGG + Intronic
1156846700 18:41673960-41673982 GAGATGAGAAAAGGAAAGAAGGG + Intergenic
1156879801 18:42063152-42063174 AAAATGGGAAAATGAGAGAGAGG - Intronic
1157116885 18:44870362-44870384 GAGCTAGGAACAGGTGACAGTGG + Intronic
1157292560 18:46420299-46420321 GAGGAGGGCACAGGAGAAAGGGG + Intronic
1158247558 18:55449076-55449098 GAGATGTGGCCAGGAGAGGGTGG - Intronic
1158493141 18:57928533-57928555 GAGAGGGGAGATGGAGAGAGGGG - Intergenic
1158493145 18:57928548-57928570 GAGAGGGGAGATGGAGAGAGGGG - Intergenic
1159574782 18:70162324-70162346 AAGATGGGAACAACAGACAGTGG + Intronic
1159610996 18:70525372-70525394 GAGATGGAAACAAGAGACACTGG - Intergenic
1159620981 18:70638037-70638059 GGGATGGGAGCAGGAAAGTGGGG - Intronic
1159633948 18:70782792-70782814 GAGAAAGGGAAAGGAGAGAGAGG - Intergenic
1159724046 18:71931162-71931184 GAGAGGGGAGGAGAAGAGAGCGG - Intergenic
1159858568 18:73618565-73618587 GAGAAGGTAAAAGGAGAAAGAGG - Intergenic
1160036763 18:75309051-75309073 GAGGTGGAGAGAGGAGAGAGAGG - Intergenic
1160446904 18:78935058-78935080 GAGATTGAAAAAGGAGAAAGAGG - Intergenic
1161233380 19:3186512-3186534 CAGCTGGGGACAGGAGAGAGGGG - Intronic
1161327851 19:3672034-3672056 GTGATGGGGCCAGGAGAGAGGGG - Intronic
1161489891 19:4556092-4556114 GAGGTGGGGACAGGAGGAAGCGG + Intronic
1161922842 19:7279494-7279516 GAGATAGGAACAGTTTAGAGTGG + Intronic
1161971324 19:7582515-7582537 GAGATGGGGACAGGAGATGAGGG - Intergenic
1161994217 19:7702588-7702610 AAAAAGGGAAGAGGAGAGAGAGG + Intergenic
1162200055 19:9013336-9013358 AAGATGGGAACAAGAGACACTGG + Intergenic
1162320159 19:9966781-9966803 GAGATGGGGGAGGGAGAGAGAGG + Intronic
1162775205 19:12975143-12975165 GAGATGGGAACGGGACAGGCAGG + Intergenic
1162775263 19:12975350-12975372 GAGGTGGGCACAGCAGAGGGAGG - Intergenic
1162884193 19:13684059-13684081 GAGAAGGGAACAGTACAGAAAGG - Intergenic
1162977816 19:14218541-14218563 GGGTTGGGAATAGGAGTGAGGGG + Intergenic
1163183038 19:15617310-15617332 GAGAAGGGAGCAGGAGGGAGTGG + Intronic
1163499444 19:17667268-17667290 AAGATGGGAACAGTAGACATTGG + Intronic
1164467769 19:28502293-28502315 GAGATGGAAATAGGAGGGTGGGG + Intergenic
1164927741 19:32143520-32143542 GATGTGTGAGCAGGAGAGAGGGG - Intergenic
1165096636 19:33413298-33413320 CAGCTGGGGACAGGAGGGAGGGG + Intronic
1165103665 19:33456213-33456235 GAGTTGGGGACAGGCGAGTGTGG - Intronic
1165309959 19:35023836-35023858 GAGATGGGCACAGGGCAGAGTGG - Intronic
1165572625 19:36788367-36788389 GAGATGGGAACAACAGACACTGG + Intergenic
1166287941 19:41844011-41844033 GAGAGAGGACCAGCAGAGAGAGG + Exonic
1166310956 19:41962335-41962357 GAGATGGGACCTGGACACAGGGG + Intergenic
1166374666 19:42320934-42320956 GAGAGGGGAACAGAAGAAAATGG - Intronic
1166730844 19:45058188-45058210 GGGAAGAGAGCAGGAGAGAGGGG - Intronic
1166910259 19:46149354-46149376 GAGAGGGGAAGAGAAGAGAGGGG - Intronic
1167197648 19:48041734-48041756 GAGATGGGAAAAGGAATGGGAGG - Intronic
1167406131 19:49309960-49309982 GAATTTGGAATAGGAGAGAGTGG - Intronic
1167643219 19:50693316-50693338 GAGAATGGAACAGGGGAGAGTGG - Intronic
1167992886 19:53375690-53375712 AAAATGAGAAGAGGAGAGAGGGG - Intronic
1168005854 19:53486552-53486574 AAAATGAGAAGAGGAGAGAGGGG - Intronic
1168152943 19:54458734-54458756 GAGCTGGGAACAGTGGGGAGAGG - Intronic
1168437338 19:56330007-56330029 AAGATGGGAACAGTAGACACTGG - Intronic
1168542686 19:57226199-57226221 GAAAGGGGAAAAGGAGTGAGAGG - Intergenic
1168543505 19:57231650-57231672 GAGAGGAGAACAGTAGAGAAGGG - Intronic
925004876 2:434404-434426 CATATGGGCCCAGGAGAGAGGGG - Intergenic
925298101 2:2791686-2791708 GAGAAGGGAAGAGAAGAGTGGGG - Intergenic
925906807 2:8544654-8544676 GAGATGGGAAGAGGAGAGAAGGG + Intergenic
926289925 2:11520607-11520629 GAAAAGGAAAGAGGAGAGAGAGG - Intergenic
926395336 2:12435470-12435492 GAGAAGGAAAAAAGAGAGAGAGG + Intergenic
926500676 2:13649190-13649212 GAGAAGGAAACAGGAGAAATTGG + Intergenic
926542340 2:14196929-14196951 GAGGTGAGAAGAGGACAGAGAGG - Intergenic
926635881 2:15179062-15179084 GAGATGGAAGCAGGAGGGACTGG + Exonic
926638098 2:15205784-15205806 CAGAAGGCAGCAGGAGAGAGAGG - Intronic
926638987 2:15215133-15215155 GACATGGGGGCAGGGGAGAGGGG - Intronic
926645981 2:15290034-15290056 GAGAGGAGAAGAGGGGAGAGGGG + Intronic
926860120 2:17300698-17300720 GAGAAGGCAACAGGGGAGATTGG - Intergenic
927077953 2:19598937-19598959 GTTTTGGGAACAGGAGAAAGGGG - Intergenic
927089984 2:19703122-19703144 GAGTTGGGAAAATGAGAGGGAGG + Intergenic
927331621 2:21871267-21871289 CACAAGGCAACAGGAGAGAGGGG - Intergenic
927407999 2:22794401-22794423 AAGTTGGGAACTGGAGAGACTGG - Intergenic
927559925 2:24063025-24063047 CAGATGGGGAGAGGAGAAAGAGG - Intronic
927599917 2:24431753-24431775 TAGCTGGGCCCAGGAGAGAGGGG + Intergenic
927648913 2:24899072-24899094 GAGCTGGGAAAAGGTGGGAGGGG - Intronic
927873719 2:26640494-26640516 GAGCTGGGAGAAGGAAAGAGGGG + Intronic
928087308 2:28353867-28353889 AAGATGGGAACAGTAGACACTGG + Intergenic
928091665 2:28378317-28378339 GACCTGGGGACAGGATAGAGAGG - Intergenic
928099503 2:28427811-28427833 GAGCTTGGATCTGGAGAGAGGGG + Intergenic
928137936 2:28702589-28702611 GGGAGGGGAACAGATGAGAGAGG + Intergenic
928255975 2:29722989-29723011 GAGATGGGAAAAGATGAGAAGGG - Intronic
928407266 2:31024197-31024219 GAGATGGGGTCAGGTGACAGTGG - Intronic
928464772 2:31513610-31513632 CAGATGGGAACATGAGCAAGTGG - Intergenic
928538329 2:32261234-32261256 GAGAGGGGAACCTGAGTGAGTGG - Intronic
928660827 2:33500332-33500354 GATTTGGGCCCAGGAGAGAGGGG + Intronic
929210304 2:39349634-39349656 GAGAAGGGAAGAGAAGGGAGAGG + Intronic
929210324 2:39349736-39349758 GGGATGGGAAAAGTTGAGAGGGG + Intronic
929233329 2:39581910-39581932 GAGAAAGGAAGAGGGGAGAGGGG - Intergenic
929562340 2:42963640-42963662 GAGGTGGGGAGAGGAGTGAGAGG + Intergenic
929645688 2:43624955-43624977 GAAATGGTTACAGGAGGGAGTGG - Intergenic
929863464 2:45698593-45698615 GAGAAAGGAAGAGGAAAGAGAGG + Intronic
930005571 2:46893467-46893489 GGGGTGGGAACAGGAGGGTGTGG - Intergenic
930763769 2:55063232-55063254 AAGATGGGAATAGAAGATAGTGG + Intronic
931103788 2:59031927-59031949 GAGATGGGGAGAGGAGAGAATGG + Intergenic
931651180 2:64470269-64470291 GAGTTGGGGGTAGGAGAGAGGGG + Intergenic
931793584 2:65688392-65688414 AAGTTGGAAATAGGAGAGAGAGG - Intergenic
931986556 2:67747821-67747843 GAGAAGGGAAGAGAAGAAAGGGG - Intergenic
932415402 2:71570534-71570556 GAGATGGTCCCAGGAGAGATGGG + Intronic
932418749 2:71589052-71589074 GAGGTGGGGACAGGAGTGGGTGG - Intronic
932455423 2:71846615-71846637 GAAAGGGGAACGGGAGAGGGAGG - Intergenic
932876457 2:75457245-75457267 GAATTGGGAACAGAATAGAGTGG + Intergenic
933209556 2:79551282-79551304 GAGAAGGCAACAGGGGAAAGAGG + Intronic
933835620 2:86243137-86243159 GAGATGGTGCTAGGAGAGAGAGG + Intronic
934034626 2:88078566-88078588 GAGATGGGAACCAGAGGGACAGG + Intronic
935679295 2:105622026-105622048 GAGATGGGAAAGGGAGAAATGGG + Intergenic
935717773 2:105953837-105953859 GCGGTGGGAATGGGAGAGAGAGG + Intergenic
936439529 2:112539134-112539156 AAGATGGGAACAGCAGACACTGG + Exonic
936717530 2:115205843-115205865 AAGATGGGAACAGTAGACACTGG + Intronic
936973077 2:118193204-118193226 GAGGTGGGAACATGAATGAGGGG + Intergenic
937055928 2:118936838-118936860 AATAGGGGCACAGGAGAGAGTGG - Intergenic
937108156 2:119338541-119338563 GAAAGGGGAAGAGGAGAGAGGGG + Intronic
937115096 2:119399303-119399325 GAGATGGGGGCAGGAGGAAGTGG - Intergenic
937258550 2:120571247-120571269 GAGATGTGAATAGGAGTAAGAGG + Intergenic
937501355 2:122482584-122482606 GACATGGTATCAGGAGAGAAGGG + Intergenic
937509827 2:122583004-122583026 GAGAGGGGAAAGGAAGAGAGGGG + Intergenic
938057595 2:128228358-128228380 GAGAAAGGAAAAAGAGAGAGGGG + Intergenic
938127086 2:128682417-128682439 GAGATGGAACCTGGAGGGAGGGG + Intergenic
938209180 2:129451656-129451678 AAGATGGGAACAGTAGACACTGG + Intergenic
938702982 2:133895463-133895485 GAGAGGGGAGGAAGAGAGAGGGG + Intergenic
938702986 2:133895478-133895500 GAGAGGGGAGGAAGAGAGAGGGG + Intergenic
938702990 2:133895493-133895515 GAGAGGGGAGGAAGAGAGAGGGG + Intergenic
938702994 2:133895508-133895530 GAGAGGGGAGGAAGAGAGAGGGG + Intergenic
938702998 2:133895523-133895545 GAGAGGGGAGGAAGAGAGAGGGG + Intergenic
938981364 2:136530417-136530439 GAGATGGGAAAAGGAAAGGCAGG - Intergenic
939399116 2:141668598-141668620 GAGCTGGAAAGAGGATAGAGTGG - Intronic
939651444 2:144767407-144767429 GAGAGGGGGAGAGGAGAGACAGG - Intergenic
940006964 2:149016828-149016850 AAGGTGGGCACAGCAGAGAGGGG + Intronic
940282859 2:152005488-152005510 AAGATGGGAACAAGAGACAATGG + Intronic
940374722 2:152945187-152945209 GAGATGGGATCATGATAGACTGG + Intergenic
940474501 2:154145203-154145225 GGAATGGGCAAAGGAGAGAGAGG - Intronic
941040464 2:160616150-160616172 GAGTGGGCAAGAGGAGAGAGAGG - Intergenic
941386424 2:164858248-164858270 TACATGGCAGCAGGAGAGAGAGG + Intergenic
941713611 2:168740982-168741004 GGGATGGGTAAAGGAGATAGAGG + Intronic
941786124 2:169500451-169500473 GTGATGGGACCAGGACAGAGAGG - Intronic
941918576 2:170828176-170828198 GAGGTGAGGACAGCAGAGAGAGG - Intronic
941987944 2:171526369-171526391 AAAATGGGACAAGGAGAGAGAGG - Intronic
942081700 2:172405717-172405739 AAGATGGGAACAGTAGACATGGG - Intergenic
942144365 2:173011967-173011989 AAGATGGAAACAGCATAGAGAGG - Intronic
942189614 2:173457046-173457068 GGGATGGCCACAGAAGAGAGGGG + Intergenic
942229645 2:173848421-173848443 GAAAGGGGAGCAAGAGAGAGAGG + Intergenic
942663600 2:178292084-178292106 GGGATGGGAGGAGGAGGGAGAGG - Intronic
943148322 2:184075003-184075025 GAGAAAGGAAGAGAAGAGAGGGG - Intergenic
943240205 2:185374862-185374884 GAAATGGAAAGAGGAAAGAGAGG - Intergenic
943374999 2:187065777-187065799 GAGATGAGATAAAGAGAGAGAGG - Intergenic
943430272 2:187791141-187791163 GAGGGAGGAAAAGGAGAGAGAGG + Intergenic
943433337 2:187831709-187831731 AAGATGTGAACAGTAGAGACTGG + Intergenic
943554632 2:189387282-189387304 AAGATGGGAACAATAGACAGTGG + Intergenic
943655227 2:190501552-190501574 TGGATGAGCACAGGAGAGAGAGG + Exonic
943968220 2:194366935-194366957 AAGATGGGAACAATAGACAGTGG + Intergenic
944039552 2:195338406-195338428 GAGAGGGGAAAGAGAGAGAGAGG - Intergenic
944089302 2:195887822-195887844 GGGAGGGGAAGAGGAGGGAGGGG - Intronic
944188694 2:196978267-196978289 GAAGGGGGAGCAGGAGAGAGAGG - Intronic
944665640 2:201956715-201956737 GAGAAGGGCACAGAAGAGGGTGG - Intergenic
944947286 2:204703392-204703414 GAGATGGGAATGGGAGAGGTTGG + Intronic
945123170 2:206480094-206480116 GGGATGGGAAAGGGAGAGACAGG + Intronic
945720048 2:213407910-213407932 GAGAGAGAGACAGGAGAGAGAGG + Intronic
945974721 2:216261350-216261372 GAGGTGAGAACAGAAGAAAGAGG - Intronic
946041097 2:216783541-216783563 GAGAAGGGACCAAGGGAGAGAGG + Intergenic
946322365 2:218961313-218961335 AAGAGAGGAACAGGAGAGAGAGG - Exonic
946405515 2:219489953-219489975 GGGAAGGGAAGAGGACAGAGGGG + Intronic
946679597 2:222199394-222199416 GAGAAAGGATCAGGAGAGGGAGG + Intergenic
946958390 2:224957155-224957177 CAGATGGGCACAGCAGAGGGCGG - Intronic
947046244 2:225989955-225989977 CAGAGGGTAGCAGGAGAGAGAGG - Intergenic
947188761 2:227479056-227479078 GAGAGAGGAGCAGGAGAAAGTGG + Intronic
947522449 2:230857769-230857791 GTGATGGGAAGAGGAATGAGGGG + Intergenic
947832699 2:233153008-233153030 GAGATGGGAAAAGGTGAACGGGG + Intronic
947909124 2:233790221-233790243 TGGAGGGGAGCAGGAGAGAGGGG - Intronic
948139720 2:235663350-235663372 GAGATGGGAGCAGCAGCGTGGGG + Intronic
948189071 2:236044521-236044543 GAGAAAGGCCCAGGAGAGAGGGG - Intronic
948295459 2:236857108-236857130 GAGAGAGAAAAAGGAGAGAGAGG - Intergenic
948618051 2:239214240-239214262 GAGAAGGGACCAGGAGCCAGGGG - Intronic
1168736343 20:141450-141472 GGGAAGGGAAGAGGAAAGAGTGG + Intergenic
1169176566 20:3521065-3521087 AAGATGGGAACAATAGACAGGGG + Intronic
1169384976 20:5141075-5141097 GAGAAAGGAGCAGGAGAAAGGGG - Intronic
1170370253 20:15640393-15640415 GAGTTGGGAAGAGGCCAGAGGGG + Intronic
1170440943 20:16378232-16378254 GAGATGGAAAGAGGTGAGGGAGG + Intronic
1170452997 20:16505141-16505163 GGGAAGGGAAGAGGAAAGAGAGG + Intronic
1170487503 20:16834043-16834065 GAACTGGAAACAGGGGAGAGGGG + Intergenic
1170699541 20:18691578-18691600 AAGATGGGAACAGCAGACACTGG + Intronic
1170901587 20:20468648-20468670 AAGACGGGAATAGGAGAGAATGG - Intronic
1170973862 20:21141962-21141984 GAGACAGGAATAGGAGACAGGGG - Intronic
1171163978 20:22954703-22954725 GAGATGGGAAGGGGAGAGGAAGG + Intergenic
1171171172 20:23016778-23016800 AAGATGACAACAGAAGAGAGAGG - Intergenic
1171412590 20:24957022-24957044 GTGAGGGGAGCAGGTGAGAGGGG + Intronic
1172761113 20:37323079-37323101 GAGATGGGGACAGGTGATGGAGG - Intergenic
1172986601 20:38996487-38996509 GCCATGGGAACATGTGAGAGAGG + Intronic
1173619200 20:44423769-44423791 GAGAGGGGAATAGGAGATGGAGG - Intronic
1173723953 20:45283930-45283952 CAGAGGGCAAGAGGAGAGAGAGG - Intergenic
1173857260 20:46258426-46258448 GAGATGGGAAGAGTAGAGGAGGG - Intronic
1173884059 20:46441290-46441312 GAGATGGGAACAGCACTGGGTGG + Intergenic
1174001752 20:47379875-47379897 GAGATGGGGACAGTAGTGGGAGG + Intergenic
1174003006 20:47388458-47388480 AAGATGGGAGCAGTAGAGATGGG - Intergenic
1174057236 20:47806517-47806539 GAGATGGAAAAGGGATAGAGCGG + Intergenic
1174147574 20:48462908-48462930 GAGGTTGGAGCAGGACAGAGAGG - Intergenic
1174667099 20:52269248-52269270 GAGGTGGGGGCAGGAGAGAAAGG + Intergenic
1174759507 20:53193298-53193320 GAGAAGGGAACAAGACAAAGAGG - Intronic
1174991624 20:55517026-55517048 TAGAGGGGGCCAGGAGAGAGGGG - Intergenic
1175019095 20:55825520-55825542 GAGATGGAAAGAGGAGAGGAAGG - Intergenic
1175155183 20:56966363-56966385 GAGAAGGAAATGGGAGAGAGAGG + Intergenic
1175193958 20:57229672-57229694 GGGTGGGGAACTGGAGAGAGAGG + Intronic
1175328424 20:58145903-58145925 GAGATGTCAGGAGGAGAGAGGGG + Intergenic
1175487359 20:59355653-59355675 GAGATAGGGAGAGGAGGGAGGGG - Intergenic
1175487437 20:59355873-59355895 GAGAGGGGAGAAGGAGAGAGGGG - Intergenic
1175487472 20:59356004-59356026 GAGATGGGAGTGGGGGAGAGAGG - Intergenic
1175531185 20:59674981-59675003 GAAGGGGGAACAGGAGAGGGGGG - Intronic
1175921396 20:62452009-62452031 GAGATGGGGGAGGGAGAGAGAGG + Intergenic
1176740387 21:10596329-10596351 GCAATGAGAACAGGAGAGATGGG - Intronic
1177030453 21:15976814-15976836 GAGAAGGAAAGAAGAGAGAGAGG - Intergenic
1177110778 21:17025510-17025532 GAGAGAGGAAGAGAAGAGAGTGG - Intergenic
1177223663 21:18225763-18225785 TGGATGGGAACAGGAGAAATTGG + Intronic
1177490704 21:21822449-21822471 TAGAAGGGAAAAGGAGGGAGGGG - Intergenic
1177751677 21:25292739-25292761 GTGTAGGGAAGAGGAGAGAGAGG - Intergenic
1177921930 21:27163286-27163308 AAGATGGGAACAGTAGACACTGG + Intergenic
1178136952 21:29638265-29638287 TACATGGCAGCAGGAGAGAGAGG + Intronic
1178301409 21:31456411-31456433 GATATGGGAACAGGAGCTCGAGG - Intronic
1178418339 21:32422395-32422417 AAGTAGGGAAAAGGAGAGAGAGG + Intronic
1179000672 21:37455109-37455131 GAGATGGGGGAGGGAGAGAGTGG + Intronic
1179084928 21:38207815-38207837 GAGGAGGGAAGAGGAGAGGGGGG - Intronic
1179096694 21:38322513-38322535 GGGATGGCAAGAGGAGAGGGTGG + Intergenic
1179114201 21:38475236-38475258 GAGATGGGAAGAAGGGAGAAGGG + Intronic
1179159525 21:38881959-38881981 AAGATGGGAACAAGAGATACTGG + Intergenic
1179324838 21:40332104-40332126 GAGAGAGGAAAAGGAGAGAATGG - Intronic
1179426805 21:41286499-41286521 TAGATGGGATCAGGAGAGTCTGG - Intergenic
1179770144 21:43609247-43609269 AAGATGGGAACAAGAGACACTGG + Intronic
1179903031 21:44404523-44404545 GAGATGGGAACAGGACGTGGAGG - Intronic
1180072927 21:45446306-45446328 GCGATGGTAACAGGACAGTGTGG - Intronic
1180082212 21:45492093-45492115 GAGTTGGGAACAGGCAGGAGAGG + Intronic
1180103629 21:45602083-45602105 GAGATGAGAACAGCATAGGGAGG - Intergenic
1181099918 22:20532151-20532173 GGAATGGGAACGGGAGACAGAGG + Intronic
1181267551 22:21639587-21639609 GAGAAGGGAACAGCAAAGAGAGG + Intergenic
1181577181 22:23802464-23802486 GGGATGGGAAGAGGAGATAGAGG - Intronic
1181792530 22:25278705-25278727 GGGAGGGGAAGAGGGGAGAGGGG + Intergenic
1182019769 22:27071628-27071650 GAGCTGGGAGCATGAGGGAGAGG + Intergenic
1182433152 22:30312650-30312672 GAGATGGGACTAGGGGAGAAAGG - Intronic
1182481141 22:30609561-30609583 GAAAAGGGAAAAGGAAAGAGAGG + Intronic
1183182001 22:36266555-36266577 AAAATGGGAACTGGAGAGTGTGG + Exonic
1183306028 22:37083683-37083705 GAGATGTGAGCAAGAGACAGTGG - Intronic
1183539753 22:38423183-38423205 GAAAGGGGAACAGGTGGGAGAGG + Intergenic
1184258570 22:43301452-43301474 GAGATGGGAACAGGACAGCTGGG - Intronic
1184478517 22:44734556-44734578 GTGATGGGAAGAAGAGAGTGGGG + Intronic
1185383491 22:50521202-50521224 CAGAGGGGAACACTAGAGAGAGG - Intronic
949218860 3:1605395-1605417 GAGGTGGGAACAGTAGACACTGG - Intergenic
949221754 3:1642868-1642890 GAGAGGGGAAGTGAAGAGAGGGG + Intergenic
949400269 3:3658549-3658571 GAGCTGGGAACAAGAAAGAAAGG - Intergenic
949828089 3:8184297-8184319 ATGATGGGGACAGGAGGGAGTGG - Intergenic
949918372 3:8982695-8982717 GAAGTGGGAACAGGGGAGGGGGG + Exonic
949922612 3:9014737-9014759 GAGATGGCAAGAGAAGAGGGAGG - Intronic
950221327 3:11198542-11198564 GAGATGGAAAAAGGAGAGTGAGG + Intronic
950452432 3:13072915-13072937 GAGCTGGGAGCTGGAGTGAGGGG - Intronic
951228044 3:20143849-20143871 AAGATGGGAACAGTAGACACTGG + Intronic
951275714 3:20683218-20683240 AAGATGGGAACAAGAGACACAGG + Intergenic
951719204 3:25679816-25679838 GACAGGGGAAGAGAAGAGAGGGG + Intergenic
951894082 3:27594567-27594589 TAGAAGGGAACAGGAGAAAAAGG + Intergenic
952238677 3:31507253-31507275 GGGCTAGGAACAGCAGAGAGGGG + Intergenic
952357798 3:32600853-32600875 AAGATGGGAAGAGGAAAGATAGG + Intergenic
952366947 3:32683443-32683465 GAGATGGGAAGAGGCATGAGGGG + Intergenic
952506197 3:34008679-34008701 GAGGAGGGCAGAGGAGAGAGAGG + Intergenic
952937781 3:38413617-38413639 GAGATGGTGAAAGGAGAGAATGG - Exonic
953029454 3:39168825-39168847 GAGAGGGGTTCAGGGGAGAGAGG - Intergenic
953230578 3:41061571-41061593 GAGAAGGGAACAAGAGACAACGG - Intergenic
953230636 3:41062045-41062067 GAGAAGGGAACAAGAGACAGGGG - Intergenic
953317892 3:41945461-41945483 GAGAGGGGAGCTGGAGAGTGTGG - Intronic
953338893 3:42117422-42117444 GAGAGAAGAACAGGAGAGGGAGG - Intronic
953546706 3:43868866-43868888 GAGATTGGGAGAGGAGAGACAGG - Intergenic
953912802 3:46901367-46901389 AGGATGGGAACAGGAGGGATGGG + Intronic
954132033 3:48565781-48565803 GAGAGGGTAACAGGAGAGAGAGG + Intronic
954172494 3:48816092-48816114 CAGATGGGAACAGGGGAGAGAGG - Intronic
954896506 3:53979592-53979614 GGGATGGGAAGAGAAGGGAGGGG - Intergenic
955003099 3:54945412-54945434 GGGCTGGATACAGGAGAGAGAGG - Intronic
955268335 3:57469798-57469820 GAGATGGGAACAACAGACACTGG + Intronic
955620626 3:60859577-60859599 GAGAAGGGAAAAGGAGAGTGAGG - Intronic
955673171 3:61423783-61423805 AAGATGGGAACAGTAGACACTGG + Intergenic
955718861 3:61860950-61860972 GAGATGGGGACAGGGAAGGGGGG - Intronic
955997144 3:64688558-64688580 GAGATGGGGACGGAAGAGAAAGG - Intergenic
956351846 3:68345816-68345838 GAGATGGGGATAGGAAAGGGTGG + Intronic
957064216 3:75507981-75508003 GAAGTGGGAACAAGAGAGTGAGG - Intergenic
958000136 3:87739971-87739993 GAGAGGCAAAGAGGAGAGAGAGG - Intergenic
958039067 3:88204815-88204837 CAGATGGGAAGAGAGGAGAGAGG + Intergenic
958053213 3:88375861-88375883 GAGATAGGAAAGGGACAGAGTGG - Intergenic
959150359 3:102600233-102600255 GAGATGAGAAGGGGACAGAGAGG - Intergenic
959429227 3:106232053-106232075 AAGATGGGAACAAGAGAAATTGG - Intergenic
959652365 3:108763536-108763558 GAGTTGGGAGAAGGAGAGAATGG + Intergenic
959663176 3:108892064-108892086 GAGAAGGAAACAGGGGAAAGGGG + Intergenic
959705640 3:109336639-109336661 GAAATGGTAACAGGAGAAAAGGG - Intronic
959769074 3:110071303-110071325 GAGAAGAGAGCAAGAGAGAGAGG - Intergenic
960298683 3:115975117-115975139 GAGATGCAAACATGAGAGACTGG + Intronic
960338020 3:116442274-116442296 GAGATGGCAACAGGAGACAAGGG - Intronic
960457960 3:117896953-117896975 GACATGTCAAAAGGAGAGAGAGG + Intergenic
960473833 3:118099606-118099628 GAGAGTGGAAGAGGCGAGAGAGG + Intergenic
960505381 3:118487312-118487334 GAGATGGGAATAGGTTAGACTGG + Intergenic
961113315 3:124304717-124304739 GGGAGGGGAAAAGAAGAGAGTGG - Intronic
961345449 3:126260660-126260682 GAGATGTGGAGAGGAAAGAGGGG - Intergenic
961425912 3:126847737-126847759 GAAAGGGGGAGAGGAGAGAGAGG - Intronic
961916633 3:130382094-130382116 GAAATGGGAACAGGAAGGAAAGG + Intronic
962388841 3:134954943-134954965 GAGAAGAGAACAGGTGAGAGGGG + Intronic
962661559 3:137606237-137606259 GAGGTGGGGACTGGGGAGAGAGG - Intergenic
963067226 3:141273396-141273418 AAGCTGGGAAAAGCAGAGAGAGG + Intronic
963098642 3:141575511-141575533 AAGATGAGAACAGGAGACAATGG - Intronic
963124538 3:141802926-141802948 CAGAAGGGAAAAGGAGAGTGAGG - Intronic
963125756 3:141814399-141814421 AAGATGGGAACAGCAGACACAGG - Intronic
963419143 3:145037277-145037299 GAGATGGGAAAAGGATGGGGAGG + Intergenic
963447540 3:145433672-145433694 GAGAGAGGAATTGGAGAGAGTGG - Intergenic
963599001 3:147361101-147361123 GAGAGGAGAAAAAGAGAGAGAGG - Intergenic
963778771 3:149465823-149465845 GGGCTGGGAACTGGAGAGACAGG + Intergenic
963953064 3:151223654-151223676 AAGATGGGAACAGTAGACACTGG + Intronic
964253053 3:154742583-154742605 AAGATGGGAACAGCAGATACTGG + Intergenic
964766142 3:160179632-160179654 GACAAGTGAACAGAAGAGAGTGG + Intergenic
965520330 3:169663462-169663484 GAGAGAGAGACAGGAGAGAGAGG - Intronic
965866007 3:173204554-173204576 AAAATGGGAGCAAGAGAGAGAGG + Intergenic
967635678 3:191799955-191799977 GAGAAGGGAAAAGGGGAGTGTGG + Intergenic
967674829 3:192284512-192284534 GATATGGGGACAGAAGGGAGAGG + Intronic
967735384 3:192946397-192946419 GGAAAGGGAAGAGGAGAGAGAGG - Intergenic
967920265 3:194609224-194609246 GAGATGGGAACTGAGGGGAGGGG + Intronic
968182524 3:196606941-196606963 GAGTTGGGCCCAGGAGACAGAGG - Intergenic
968496163 4:917621-917643 GGGATGGGAACAGGAAAGCAGGG + Intronic
968663676 4:1809566-1809588 GAGGTGGGGACAGCAGAGATGGG - Intergenic
968724527 4:2238217-2238239 GAGAAGGTAGCAGTAGAGAGGGG - Intronic
968797018 4:2713626-2713648 AAAATGGGAAGAGGAGAGACAGG - Intronic
968957439 4:3726452-3726474 GAGAGAGGGAGAGGAGAGAGAGG + Intergenic
969353004 4:6609015-6609037 CAGATGGCATCTGGAGAGAGAGG + Intronic
969519488 4:7667596-7667618 GAGATGGACACTGGAGGGAGGGG - Intronic
969711328 4:8845906-8845928 GAGAAGGGAAGGAGAGAGAGGGG + Intergenic
969780762 4:9401270-9401292 AAAATGGGAACAAGAGAGATTGG - Intergenic
969853966 4:9984257-9984279 GAGAGGTGAGCAGGAGAGTGGGG - Intronic
970269568 4:14330580-14330602 GTGGTGGGAGCATGAGAGAGAGG - Intergenic
970834574 4:20387109-20387131 GAGATGTGAACAGCAGTGATGGG + Intronic
971043681 4:22781845-22781867 GAGATGCTAAGAGCAGAGAGTGG + Intergenic
971044232 4:22787443-22787465 AAGATGGGAACAGTAGACATTGG - Intergenic
971735434 4:30443570-30443592 GAGCTGGGAACAGAGAAGAGAGG - Intergenic
973098998 4:46238599-46238621 GACATGGGAACATAAAAGAGAGG + Intergenic
973220251 4:47717981-47718003 GAGATGGATACAGGAGGGAGGGG + Intronic
973287421 4:48434012-48434034 AAGATGGGAACAGTAGACATTGG - Intergenic
973585420 4:52385299-52385321 AAGATGGGAACAGAAGACACTGG - Intergenic
973692159 4:53446899-53446921 GAGTTGGGGGCAGGAAAGAGTGG - Intronic
975504398 4:75122460-75122482 GGGAAGGAAACAGGGGAGAGAGG + Intergenic
976099846 4:81550112-81550134 CATATGAGAACAGGAGATAGCGG - Intronic
976266163 4:83186985-83187007 GAGAGGGGAGAAGGAGAGGGAGG + Intergenic
976302270 4:83526366-83526388 GAGTTGGGAAGAGGAGAGCCTGG + Intergenic
976365169 4:84225133-84225155 GAGAAGGAAAGAAGAGAGAGAGG + Intergenic
976615254 4:87069563-87069585 GAGAGGGAGAGAGGAGAGAGAGG - Intronic
976744836 4:88392148-88392170 GAGAAGGGAAGAGGACAGAAGGG - Intronic
976834585 4:89356739-89356761 AAGATGGGATAGGGAGAGAGAGG - Intergenic
977257771 4:94758686-94758708 GAGAGAGAAGCAGGAGAGAGAGG - Intronic
977376624 4:96213129-96213151 GAGAAGGGAGGAGAAGAGAGGGG - Intergenic
977498452 4:97806334-97806356 GAGATGGGAACAGTAGACACTGG + Intronic
977559465 4:98517635-98517657 GAGATGGGGAGGGGAGAGAAGGG + Intronic
977661008 4:99586111-99586133 CAGATGGGAAAGGGAGACAGGGG - Intronic
977757392 4:100689322-100689344 GGGCTGGGAACAGGAAAGACAGG - Intronic
977768052 4:100824262-100824284 GAGCTGGAAAGAGGAGACAGGGG - Intronic
977894594 4:102349258-102349280 GAGAAGGGAAGAAGAGAAAGGGG - Intronic
977938012 4:102827754-102827776 GAGATTGGACCAGGAGGGCGGGG + Intronic
978718414 4:111874528-111874550 AAGATGGGAACAATAGACAGTGG - Intergenic
978739235 4:112119002-112119024 GAGAAGGAAACAGGAGAGGAGGG + Intergenic
978753243 4:112275589-112275611 AAGATTGGCAAAGGAGAGAGTGG - Exonic
978765473 4:112400860-112400882 AAGATGTGAAGAGAAGAGAGAGG + Intronic
978924829 4:114230960-114230982 GTGGTGGGAGCAGGAGAAAGAGG + Intergenic
979211570 4:118111133-118111155 GAGATGGCAACAGTAGACACTGG + Intronic
979275548 4:118811116-118811138 GGAATAGGATCAGGAGAGAGTGG + Intronic
979597206 4:122547326-122547348 GAGATAAGAACAAGAGAGAGGGG - Intergenic
979702359 4:123684320-123684342 GAGAGGGAGACAGAAGAGAGGGG - Intergenic
979715458 4:123832208-123832230 AAGATGGGAAAAGAAGAAAGAGG - Intergenic
979828550 4:125270948-125270970 GAGATGGGAACAATAGACACTGG - Intergenic
979834020 4:125339026-125339048 GAGATGGTAACAGCACAGAATGG - Intronic
980099173 4:128524193-128524215 AAGATGGGAACAGTAGACACTGG + Intergenic
980318221 4:131234077-131234099 TATATGGGTACAGGATAGAGGGG - Intergenic
980877227 4:138673915-138673937 GAGATGGGAAGGAGAGAGAGAGG + Intergenic
980896989 4:138869139-138869161 GGGAAGGGAAGGGGAGAGAGAGG + Intergenic
981328639 4:143482771-143482793 AACATGGGCATAGGAGAGAGGGG - Intergenic
981536994 4:145810505-145810527 GAGAAGGGGACAGTAGTGAGAGG - Intronic
981621503 4:146705121-146705143 AAGATGGGAACAGTAGACACTGG - Intergenic
981711523 4:147713497-147713519 GAGATGGGAACAATAGACACGGG + Intergenic
982125484 4:152180455-152180477 GAGAAGGGATCTGGAGTGAGGGG + Intergenic
982176816 4:152713451-152713473 GGGAAGGGAAGAGGGGAGAGAGG + Intronic
982283980 4:153715445-153715467 GAGATGGGGACAGGAGGAGGAGG + Intronic
982368075 4:154602604-154602626 GAGATGGTAGCAGGAGAGGCTGG + Intergenic
982618110 4:157667703-157667725 TAGAAGGGAACACGAGAGTGGGG - Intergenic
983045431 4:162981306-162981328 GAGATGTGAAGAGGAAAGAAAGG - Intergenic
983053077 4:163070996-163071018 GAGAGGGGAACAGAAGATACTGG - Intergenic
984154068 4:176172798-176172820 GAGAAGGGATGAAGAGAGAGAGG + Intronic
984199849 4:176704832-176704854 GACATGGCTACAGTAGAGAGGGG - Intronic
984363729 4:178771232-178771254 GAATTGGGAAAAGAAGAGAGTGG - Intergenic
984587937 4:181584218-181584240 GAGGTGGGGAAAGAAGAGAGTGG + Intergenic
986328862 5:6702947-6702969 GAGAGGGGAAGGGGAGAGGGAGG - Intergenic
986769359 5:10957761-10957783 GAGAGGGAAAAAGGAGACAGGGG + Intergenic
986788149 5:11134126-11134148 GAGGAGGGAGCAGGAGAAAGGGG + Intronic
987258329 5:16179662-16179684 GAGAGGGGAAAAGGAGGGAGGGG + Exonic
987901255 5:24014716-24014738 GAGATGGAAACAAGATAGACGGG + Intronic
988019927 5:25609163-25609185 GAGAGGGAAAGAGGAGACAGGGG - Intergenic
988217132 5:28289084-28289106 GAGATGGGAACATGTGCGAAAGG + Intergenic
988604399 5:32667467-32667489 GAGAGGGGAACTGGATAGGGAGG + Intergenic
988782662 5:34537505-34537527 GAGCTGGGGAAAGGAGAAAGGGG + Intergenic
988852934 5:35197108-35197130 AAGTTGGGGACAGGAGAAAGTGG - Intronic
988959792 5:36358386-36358408 GAGTTTGGAAAAGGGGAGAGGGG + Intergenic
990197630 5:53336199-53336221 AAGATGGGAACAATAGACAGGGG - Intergenic
990779473 5:59343316-59343338 GTGATGGGAACAGGAGGGATTGG - Intronic
990854396 5:60247708-60247730 GAGAGAGGGAGAGGAGAGAGAGG - Intronic
990865921 5:60379750-60379772 GAGATGGGATGAGGAGAAAGAGG - Intronic
990995826 5:61731438-61731460 GAGAGGGAGAAAGGAGAGAGAGG + Intronic
991198524 5:63962181-63962203 GAGAAGAGAGGAGGAGAGAGGGG - Intronic
991208967 5:64083029-64083051 CACATGGCAGCAGGAGAGAGAGG - Intergenic
992084929 5:73269892-73269914 GAGTTGGGAACAGGAAACTGAGG - Intergenic
992104438 5:73437742-73437764 GAAATGGCAACAGGAGCGGGAGG - Intergenic
992226120 5:74621000-74621022 TATATGGGTACAGGATAGAGGGG + Intergenic
992430736 5:76709039-76709061 GAAAGGGGAACAGGAGCCAGGGG + Intergenic
992887302 5:81171230-81171252 GGCATGGGATCAGGAGTGAGTGG - Intronic
993175184 5:84474944-84474966 CACATGGTAGCAGGAGAGAGAGG + Intergenic
993388733 5:87291578-87291600 GAGGTGGGACCTGGTGAGAGGGG + Intronic
994410182 5:99397597-99397619 AAGATGGGGACAGTAGACAGTGG + Intergenic
994483638 5:100367683-100367705 AAGATGGGGACAGTAGACAGTGG - Intergenic
994591504 5:101779126-101779148 AAGATGGGAACAGCAGATACTGG + Intergenic
994992387 5:107013788-107013810 GCCAATGGAACAGGAGAGAGAGG - Intergenic
995154801 5:108898452-108898474 CAGAAAGGAAGAGGAGAGAGGGG - Intronic
995815011 5:116158179-116158201 GAGAGGGGAGACGGAGAGAGGGG - Intronic
995815015 5:116158194-116158216 GAGAGGGGAGACGGAGAGAGGGG - Intronic
995815019 5:116158209-116158231 GAGAGGGGAGACGGAGAGAGGGG - Intronic
995815023 5:116158224-116158246 GAGAGGGGAGACGGAGAGAGGGG - Intronic
995815027 5:116158239-116158261 GAGAGGGGAGACGGAGAGAGGGG - Intronic
995815031 5:116158254-116158276 GAGAGGGGAGACGGAGAGAGGGG - Intronic
995815035 5:116158269-116158291 GAGAGGGGAGACGGAGAGAGGGG - Intronic
995815043 5:116158294-116158316 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815048 5:116158309-116158331 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815053 5:116158324-116158346 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815058 5:116158339-116158361 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815063 5:116158354-116158376 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815068 5:116158369-116158391 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815073 5:116158384-116158406 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815078 5:116158399-116158421 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815083 5:116158414-116158436 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815088 5:116158429-116158451 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815093 5:116158444-116158466 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995815098 5:116158459-116158481 GAGAGGGGAGAGGGAGAGAGGGG - Intronic
995857807 5:116612020-116612042 GAGATGGCAATGGGAGAGTGGGG - Intergenic
995994312 5:118281999-118282021 GAGAGGGAGACAGGGGAGAGAGG - Intergenic
996084396 5:119289662-119289684 GTGATGGGAACAGGAGGAAGAGG - Intronic
996769850 5:127074169-127074191 GAGGTGGAAACAGGCTAGAGAGG + Intergenic
996874178 5:128223197-128223219 GAGAGGAGAAAGGGAGAGAGAGG - Intergenic
997446149 5:133941830-133941852 TAGATGGGAAGAGAAGAAAGGGG - Intergenic
997945671 5:138198780-138198802 CAGCTGGCAGCAGGAGAGAGAGG + Exonic
998262419 5:140641697-140641719 GACAGAGGAAAAGGAGAGAGAGG + Exonic
998507137 5:142681105-142681127 GTGATGAGAACAGGTGTGAGGGG - Intronic
998590901 5:143477110-143477132 TAAATGGGAAGAGGAGAGGGTGG - Intergenic
998798406 5:145843136-145843158 GAGAAGGGGAAAGGAGAGAAGGG + Intergenic
998938932 5:147260254-147260276 GAGAGGGGAGAGGGAGAGAGAGG - Intronic
999065654 5:148683105-148683127 TACATGGCAGCAGGAGAGAGGGG + Intergenic
999070679 5:148740387-148740409 GGGATGGGAATAGGATCGAGGGG - Intergenic
999099271 5:149009157-149009179 GAGCAAGGATCAGGAGAGAGAGG - Intronic
999177792 5:149643661-149643683 GACATGGGCCCAGGAGAGTGAGG + Intergenic
999266448 5:150269817-150269839 GGGAGGAGAACAGGAGAGATGGG + Intronic
999272223 5:150303038-150303060 GGGATGGGGAAAGGAGGGAGTGG + Intronic
999416404 5:151400181-151400203 AAGATGGGAACAGTAGACACTGG - Intergenic
999673011 5:153974015-153974037 GAGCTGGGACCAGGAGGGAGTGG + Intergenic
999679668 5:154045046-154045068 GGGATGGGGAAGGGAGAGAGTGG - Intronic
999742674 5:154568521-154568543 GAGATGGGGGAAGGGGAGAGAGG + Intergenic
999828007 5:155292616-155292638 GAGATAGGAGCATGAGTGAGTGG + Intergenic
999945694 5:156592777-156592799 GAGATTGAAACAGCAGAGATAGG - Intronic
1000120500 5:158193396-158193418 AAGATGGGAACAGTAGACAGTGG - Intergenic
1000255879 5:159537782-159537804 GGGGTGGGAACTGGAGAGTGAGG - Intergenic
1000575538 5:162970723-162970745 TACATGGAAACAGGAGTGAGGGG - Intergenic
1001237803 5:170044806-170044828 GAGGTAGGAGGAGGAGAGAGGGG - Intronic
1001564255 5:172689280-172689302 GAGAAGGGGACAAGAGAAAGAGG + Exonic
1001632967 5:173190241-173190263 GAGATGGGAACAGTAAACACTGG - Intergenic
1001647683 5:173294513-173294535 CAGATGGGAAACGGAGAAAGGGG + Intergenic
1001681266 5:173558789-173558811 GAGATGGGAAAATGGGAGGGAGG - Intergenic
1001724648 5:173887068-173887090 GACTTGGAAACAGGAGTGAGGGG + Intergenic
1001777205 5:174337707-174337729 GAGAAGGGAACAGGAGACAGCGG - Intergenic
1001785357 5:174408004-174408026 GATATGGGAAAAGGGGAGAGAGG - Intergenic
1002199463 5:177519482-177519504 AAGAGGGAAACAGGAAAGAGTGG + Intergenic
1002322253 5:178382931-178382953 GAGCTGAGGACAGGAGGGAGGGG + Intronic
1002589370 5:180278783-180278805 GAGAGAGAAAAAGGAGAGAGGGG - Intronic
1002898964 6:1394882-1394904 GAGGAGGGGAGAGGAGAGAGCGG - Exonic
1002916162 6:1529519-1529541 GAGCTGGGAACAGGAGAAGTGGG - Intergenic
1002925263 6:1602106-1602128 GAGCAGGGAAAAGGAGAGAGTGG - Intergenic
1003052270 6:2790753-2790775 GAGATGAGGGCAAGAGAGAGAGG - Intergenic
1003094121 6:3129240-3129262 GAGATGAGATGCGGAGAGAGGGG - Intronic
1003477749 6:6499824-6499846 CAGATGGGAACATGAAACAGAGG + Intergenic
1003539992 6:7010200-7010222 GAGAAGAGAAGAGAAGAGAGAGG + Intergenic
1003633947 6:7814129-7814151 TAGCTGGTAACAGAAGAGAGAGG - Intronic
1003644669 6:7904871-7904893 GGGATGGGAGCAGGGGAGAGAGG - Intronic
1003751687 6:9065741-9065763 GAGTTGCGAGCAGGAGAGTGAGG + Intergenic
1004260344 6:14102345-14102367 GAGAGGAGAACAGGTGAGAAAGG + Intergenic
1004281148 6:14280895-14280917 GATATGTCACCAGGAGAGAGCGG - Intergenic
1004478303 6:15994782-15994804 GTGTTTGGAACAGGAGAGAAAGG - Intergenic
1004624347 6:17360814-17360836 GAGATGGGAACAACAGACACTGG + Intergenic
1004733340 6:18380409-18380431 GAGATGGGGAAAGGAGAAGGTGG + Intergenic
1005433809 6:25786750-25786772 GAGGTGTGACCAGGAGAGAAAGG - Intronic
1005731497 6:28701501-28701523 GACAGAGGATCAGGAGAGAGTGG + Intergenic
1005835064 6:29702612-29702634 GTGCTGGGAACAGGAGAGCCTGG + Intergenic
1005884858 6:30089630-30089652 GAGATGGGATCACAAGAGAGGGG + Intergenic
1005906197 6:30262980-30263002 TAGGTGGAGACAGGAGAGAGAGG + Intergenic
1005960592 6:30690367-30690389 GAGATGGGCACAGCCTAGAGAGG - Intronic
1007003253 6:38335081-38335103 TACATGGCAGCAGGAGAGAGAGG - Intronic
1007005030 6:38353396-38353418 GAGAGGGGAAGAAGAGAGACGGG + Intronic
1007226621 6:40320004-40320026 CAGGTGGGAAGAGTAGAGAGTGG + Intergenic
1007229392 6:40337901-40337923 GAGATGGGGACAGTGGAGACTGG - Intergenic
1007332369 6:41122835-41122857 GAGGTGGGAGCAGTAGACAGGGG + Intergenic
1007409403 6:41653280-41653302 GAGAGGGGGACGGGTGAGAGAGG - Intronic
1007428237 6:41760797-41760819 GATATGGGAAAAGGAAAAAGAGG - Intergenic
1007500990 6:42296715-42296737 GAGAGGGGAAAAGGAAAAAGAGG + Intronic
1007625559 6:43244240-43244262 GTGATGGGAACAGGTGAAAGAGG - Intronic
1008081569 6:47200118-47200140 AAGATGGGAACAAGAGACACTGG - Intergenic
1008128014 6:47690352-47690374 AAGATGGGAAGAGAAAAGAGAGG - Intronic
1008485506 6:52030680-52030702 GGGGTGGGAAGATGAGAGAGGGG + Intronic
1008498473 6:52156381-52156403 GAAGTGGGAAGAGGAGACAGAGG - Intergenic
1008963984 6:57295903-57295925 GGGATGGGAATAGGATAGAAGGG + Intergenic
1008975386 6:57419681-57419703 GAGATGAGGGCAGGAGGGAGGGG + Intronic
1008979810 6:57470398-57470420 GAGAGGGGGAGAGGGGAGAGGGG - Intronic
1008979817 6:57470413-57470435 GAGAGGGGGAGAGGGGAGAGGGG - Intronic
1008979824 6:57470428-57470450 GAGAGGGGGAGAGGGGAGAGGGG - Intronic
1008979831 6:57470443-57470465 GAGACGGGGAGAGGGGAGAGGGG - Intronic
1009164262 6:60321194-60321216 GAGATGAGAGCAGGAGGGAGGGG + Intergenic
1009560837 6:65240459-65240481 AAGATGGGAACAATAGAGACAGG - Intronic
1010110021 6:72216344-72216366 GAGCTGGGGACAGGAGAAGGTGG - Intronic
1010359919 6:74981091-74981113 AAGATGGGAACAGTAGACACTGG + Intergenic
1011190083 6:84719321-84719343 GAGAGAGGAACAAGAGAGAGAGG - Intronic
1011190084 6:84719336-84719358 GAGAGAGGAACAAGAGAGAGAGG - Intronic
1011459748 6:87590453-87590475 GAGATGGAAAAATGAGAGACTGG - Intronic
1011881347 6:92031900-92031922 GAAATGTGTACAGGAGAAAGAGG - Intergenic
1012211821 6:96528816-96528838 GAGATGCGGACTGGAGAGAGAGG - Intronic
1012427908 6:99134422-99134444 GAGAGGGGAAAGGGAGTGAGGGG + Intergenic
1012462706 6:99481691-99481713 AAGATGGCAACAGTAGAGAGTGG - Intronic
1012852611 6:104465008-104465030 CAGAGGGGAAGAGAAGAGAGTGG - Intergenic
1012942270 6:105427867-105427889 GAAATGGGAAGAGGAGAAGGTGG + Intergenic
1013215706 6:108025438-108025460 CAGAGGGCAAGAGGAGAGAGGGG + Intergenic
1013259458 6:108426811-108426833 GGGATGGGAAGAGGGAAGAGTGG - Intronic
1013403361 6:109820039-109820061 GCTATGGGAACAGAGGAGAGGGG + Intronic
1013596514 6:111665583-111665605 GACATGGGTACACTAGAGAGAGG + Intronic
1014169341 6:118261804-118261826 GAGTTAGGAAAAGCAGAGAGAGG - Intronic
1014510728 6:122318741-122318763 AAGAAGGTAACAGGAGAGATAGG + Intergenic
1015695080 6:135970958-135970980 GAGATGGGAAGAGGAGGGTAAGG + Intronic
1015945157 6:138492217-138492239 GGGATGGGAGCAGGAGGGAGTGG + Intronic
1016998273 6:149976463-149976485 TAGATGAGAGCAGGTGAGAGAGG + Intergenic
1017103489 6:150867091-150867113 GAGATGGGAGAAGGGGAGTGGGG - Intronic
1017282067 6:152636576-152636598 GAGACAGGGAGAGGAGAGAGAGG - Intronic
1017567618 6:155705142-155705164 AAGATGGGAACAACAGACAGTGG + Intergenic
1017706824 6:157131478-157131500 GAGGAGGGAACGGGGGAGAGAGG + Intronic
1018496279 6:164348570-164348592 GAGATTGGAGCTGGAGACAGAGG + Intergenic
1018524175 6:164689491-164689513 GAGAAGTAAACAGGAGAGAGTGG - Intergenic
1018769937 6:166961741-166961763 AAGATGGCAACAGTAGACAGTGG - Intergenic
1019138847 6:169930295-169930317 AAGAGGGGATCAGAAGAGAGAGG - Intergenic
1019173359 6:170147184-170147206 GAGGAGGAAACAGGAGAGAAGGG + Intergenic
1019878226 7:3834855-3834877 GAGAGGGGACCAGGAAAGGGAGG - Intronic
1020463772 7:8453149-8453171 GAGAGGGGGAAAGGGGAGAGAGG + Intronic
1020496153 7:8855411-8855433 TAGGTGGGAACAGGAGTGGGAGG + Intergenic
1020676209 7:11187780-11187802 AAGATGGGAACAGTAGATACTGG - Intergenic
1020883517 7:13793692-13793714 GAAATGTGAAAAGGAGAGACTGG - Intergenic
1021113535 7:16723361-16723383 GAGTTGCGAACAGGAGAAAGGGG - Intergenic
1021370481 7:19839096-19839118 AAGATGGGAACAATAGAGATGGG - Intergenic
1021437793 7:20641063-20641085 GAAATGGAAGCACGAGAGAGGGG - Intronic
1021495773 7:21273049-21273071 GAGATGGCAACAAAAGAGAAAGG + Intergenic
1022056633 7:26742395-26742417 GAGATGGGAAGAAGGGAGAGGGG + Intronic
1022059067 7:26772404-26772426 GAGATGAGAACAGGAGACAGTGG - Intronic
1022532438 7:31075487-31075509 GTGATGTGAGCAGGAGAGAGTGG - Intronic
1022621950 7:31993436-31993458 TAGAAGGGAACAAGAAAGAGAGG + Intronic
1022829046 7:34046340-34046362 GTGCTGGGGACAGGAGAGAATGG - Exonic
1023582877 7:41700754-41700776 GAGAGGGGGAGAGAAGAGAGAGG + Intronic
1023705206 7:42933469-42933491 GGGAAGGGAAGAGGAGAGGGGGG - Intronic
1023763838 7:43492350-43492372 GAGAGGGGAAAAGGACAGAGGGG - Intronic
1023809668 7:43902108-43902130 GAGAAGGGAGGAGGAGAGGGAGG + Intronic
1023888458 7:44376731-44376753 GAGATGGACACAGGAGGGAAAGG - Intergenic
1023888549 7:44377053-44377075 GAGATGGACACAGGAGGGACAGG - Intergenic
1024087905 7:45911896-45911918 GAGATGGGAAGGGGACAAAGCGG + Intergenic
1024584984 7:50834378-50834400 GAGATTCCAACAGAAGAGAGTGG + Intergenic
1024725509 7:52189484-52189506 GGGAAGGGAACAGGAGGGAAGGG + Intergenic
1024749785 7:52452205-52452227 GAGAGCAGAACAGGAAAGAGTGG + Intergenic
1024890496 7:54196061-54196083 GAGCTGCGAATAAGAGAGAGAGG + Intergenic
1024964315 7:55008457-55008479 GAGAGGGGAAAAGCAGAGATAGG + Intergenic
1025002487 7:55328375-55328397 GAGGAGGGAGCAAGAGAGAGAGG - Intergenic
1025140712 7:56461164-56461186 AAGATGGGAACAGCAGACACTGG + Intergenic
1025163764 7:56691774-56691796 AAGATGGGAACAGCAGACACTGG - Intergenic
1025240698 7:57269731-57269753 AAGATGGGAACAGCAGACACTGG + Intergenic
1025972764 7:66343371-66343393 AAGATGGGAACAGTAGACACTGG + Intronic
1026070970 7:67119332-67119354 GCGCTGGGCACAGGAGAGAAAGG - Intronic
1026125662 7:67577380-67577402 GTGGTGGGACAAGGAGAGAGAGG + Intergenic
1026206092 7:68258798-68258820 GAGAGGAGGGCAGGAGAGAGTGG - Intergenic
1026477192 7:70747013-70747035 ATGATGGGGACAGGACAGAGTGG + Intronic
1026625547 7:71988780-71988802 TACATGGGAATAGGAGGGAGGGG + Intronic
1026649312 7:72201243-72201265 AAGATGGGAACAAGAGATACTGG + Intronic
1026652016 7:72223966-72223988 AAGATGGGAACAACAGACAGTGG + Intronic
1026705930 7:72692966-72692988 GCGCTGGGCACAGGAGAGAAAGG + Intronic
1027222713 7:76224043-76224065 GAGAAGGGAGAGGGAGAGAGGGG - Intronic
1027239341 7:76317356-76317378 GAGATGGGAAGCGGGGAGACTGG + Intergenic
1027265723 7:76494245-76494267 GAGGTGGGGGCAGGAGGGAGAGG + Intronic
1027268298 7:76505753-76505775 CAGAGGGGAGGAGGAGAGAGAGG - Exonic
1027317094 7:76992362-76992384 GAGGTGGGGGCAGGAGGGAGAGG + Intergenic
1027370217 7:77501218-77501240 GGGAAGGGAACAGGAGTGTGGGG + Intergenic
1027386352 7:77662989-77663011 GAGAGGGAAGAAGGAGAGAGAGG + Intergenic
1027486759 7:78771165-78771187 GAGAGGGGAGAAGGAGAGAGAGG - Intronic
1028309200 7:89309163-89309185 GAGATGGGAACAATAGACACTGG - Intronic
1028618893 7:92801962-92801984 GAGAAGGGAAGGGGAGAGAACGG - Intronic
1028966462 7:96807185-96807207 TACATGGTAGCAGGAGAGAGAGG + Intergenic
1029667890 7:102007622-102007644 CTGACGGGAACAGGAGAGAGTGG - Intronic
1030048289 7:105516777-105516799 GGGTTGGGGAGAGGAGAGAGAGG + Intronic
1030326990 7:108230213-108230235 GGGGTGGGAGCATGAGAGAGAGG - Intronic
1030375730 7:108751333-108751355 GGAATGGGAGGAGGAGAGAGGGG - Intergenic
1030472600 7:109985225-109985247 GAAAAGGGAAAAGGAGAAAGAGG + Intergenic
1030478345 7:110068368-110068390 GAGAAGGGAAGAGTGGAGAGGGG - Intergenic
1030699564 7:112622894-112622916 GAGATGGGGAGAGGGAAGAGGGG + Intergenic
1030708894 7:112726104-112726126 GCCATGGGAACAGAACAGAGTGG - Intergenic
1031256236 7:119452113-119452135 GAAATGAGAAGAGGTGAGAGTGG + Intergenic
1031270030 7:119636613-119636635 GAAGTGGGAACAGGGGAGATTGG - Intergenic
1031621105 7:123934824-123934846 AAGCTGGGAAGAGGAGGGAGGGG + Intronic
1031626528 7:123998855-123998877 GAGGTGGTAACTAGAGAGAGGGG + Intergenic
1031789637 7:126084902-126084924 GAGATGGTGTGAGGAGAGAGAGG + Intergenic
1031842684 7:126764909-126764931 GAGTTGGAAACCTGAGAGAGGGG - Intronic
1032099888 7:128965916-128965938 GAGATGGGGAGAGGGGAGAATGG + Intronic
1032493841 7:132345920-132345942 AAGAGGAGAACAGGATAGAGTGG - Intronic
1033039857 7:137908267-137908289 GAGAGGGGAGCTGGAGAGGGCGG + Exonic
1033665863 7:143439958-143439980 GATATGGCAAGAGAAGAGAGAGG + Intergenic
1033921234 7:146394891-146394913 GAGATGCAAACAGGTGGGAGGGG - Intronic
1034388131 7:150757924-150757946 GGGATGAGAAGAGGAGAGAGTGG + Intergenic
1034532153 7:151702521-151702543 CAGATGGGGAGAGGAGATAGGGG - Intronic
1034534971 7:151720851-151720873 GAGAATGGAACGGGAGGGAGAGG + Intronic
1034697761 7:153069183-153069205 GAGATGAGAAGAGAAGTGAGTGG + Intergenic
1034880884 7:154761642-154761664 GTGGTGGGAGCAGGAGTGAGAGG + Intronic
1035237649 7:157509149-157509171 GAGAGGGGAGAGGGAGAGAGAGG + Intergenic
1035237700 7:157509303-157509325 GAGAGGGGAGAGGGAGAGAGAGG + Intergenic
1035237705 7:157509320-157509342 GAGAGGGGAGAGGGAGAGAGAGG + Intergenic
1035237710 7:157509337-157509359 GAGAGGGGAGAGGGAGAGAGAGG + Intergenic
1035237715 7:157509354-157509376 GAGAGGGGAGAGGGAGAGAGAGG + Intergenic
1035237720 7:157509371-157509393 GAGAGGGGACAGGGAGAGAGAGG + Intergenic
1035237725 7:157509388-157509410 GAGAGGGGACAGGGAGAGAGAGG + Intergenic
1035237730 7:157509405-157509427 GAGAGGGGACAGGGAGAGAGAGG + Intergenic
1035237735 7:157509422-157509444 GAGAGGGGAGAGGGAGAGAGAGG + Intergenic
1035256122 7:157628870-157628892 AAGAAGTGAACAGAAGAGAGTGG - Intronic
1035335450 7:158124996-158125018 GAGAAGGGAAGAGGGGAGAAGGG + Intronic
1036278199 8:7375202-7375224 AAAATGGGAACAAGAGAGATTGG - Intronic
1036343324 8:7936688-7936710 AAAATGGGAACAAGAGAGATTGG + Intronic
1036386610 8:8287316-8287338 GACATGGAAAGAGGAGAGAGTGG - Intergenic
1036838660 8:12097451-12097473 AAAATGGGAACAAGAGAGATTGG + Intergenic
1036860449 8:12343695-12343717 AAAATGGGAACAAGAGAGATTGG + Intergenic
1037092086 8:14933017-14933039 GAGATGGAAACAAGAGACAATGG + Intronic
1037098002 8:15008673-15008695 GAGATGGGAAGAGAGGGGAGGGG + Intronic
1037109258 8:15146050-15146072 GAGACGGGAAGAAGTGAGAGGGG + Intronic
1037366271 8:18125373-18125395 AGGGTGGGAGCAGGAGAGAGAGG + Intergenic
1037382090 8:18296535-18296557 AAGATGGGAACAGTAGATACTGG - Intergenic
1037471162 8:19212408-19212430 GGGGAGGGAACAGGATAGAGAGG - Intergenic
1037500773 8:19483530-19483552 TAGAAGGGAACAGGACAGAGAGG - Intronic
1037516903 8:19641164-19641186 GAGAAGTGAAGGGGAGAGAGAGG - Intronic
1037666756 8:20976375-20976397 GAGAAGAGAACAGGAGGGAGAGG + Intergenic
1037681797 8:21103849-21103871 CAGAAAGGAAGAGGAGAGAGAGG + Intergenic
1037749774 8:21673701-21673723 GAGAGAGAGACAGGAGAGAGAGG - Intergenic
1037776515 8:21839097-21839119 GAGATGGGAACAAGATAGACAGG + Intergenic
1037799481 8:22024656-22024678 GAGAAGGGAAGGGGAGAGGGAGG + Intronic
1038145620 8:24892753-24892775 GTGATGGGGTCAGGAGAGAAGGG - Intergenic
1038216596 8:25567374-25567396 GAGGAGGGGACAGAAGAGAGGGG + Intergenic
1038394996 8:27240105-27240127 GAAACGGGAACATGAGAGAGAGG - Exonic
1038492414 8:27980602-27980624 GCGTTGGGAAGAGGAGGGAGGGG - Intronic
1038630574 8:29239499-29239521 AAGATGGGAACAAGAGACACTGG + Intronic
1039326496 8:36490691-36490713 GATATGGGAACAGTGGAGACAGG + Intergenic
1039901203 8:41753714-41753736 AAGATGGGAACAGGAGACACTGG - Intronic
1041140958 8:54818981-54819003 GGGATGGGAAGAGGAGGGGGAGG + Intergenic
1041437362 8:57857085-57857107 GAGATGGCACCAGGAGAAGGTGG + Intergenic
1041647148 8:60264524-60264546 GAGGATGGGACAGGAGAGAGAGG + Intronic
1041726440 8:61021910-61021932 AAGATGGGAACAGTAGACACTGG - Intergenic
1041844385 8:62311252-62311274 GAGATAGGCACAGCAGAGACGGG + Intronic
1041908979 8:63067790-63067812 AAGATGGGAACAGTAGACACTGG - Intronic
1041927444 8:63251245-63251267 TACATGGCAGCAGGAGAGAGAGG - Intergenic
1042112740 8:65398065-65398087 GATATGGGAGCAGGAGTGTGTGG + Intergenic
1042882200 8:73505944-73505966 GGCATGGGAACAAGAGAGAGAGG - Intronic
1042944957 8:74145224-74145246 GAGATGGGCACAGGAGGGTGAGG + Intergenic
1043689508 8:83132625-83132647 CACATGGCAGCAGGAGAGAGAGG - Intergenic
1043889655 8:85642434-85642456 GGGATGGGGACAGGCGCGAGGGG + Intergenic
1043908345 8:85833111-85833133 GAGATGGGAGGAGGGGCGAGGGG - Intergenic
1043980544 8:86633403-86633425 AAGATTGGAACAGTAGAGGGTGG + Intronic
1044693304 8:94899656-94899678 GACTTGGGAACAGAAGAGAAAGG - Intronic
1045060481 8:98406471-98406493 AAGATGGGAACAGTAGACACTGG - Intronic
1045670822 8:104551540-104551562 AAGATGGGAACAGTAGACACTGG - Intronic
1046196586 8:110871708-110871730 GTAAGGGGAAAAGGAGAGAGTGG + Intergenic
1046450243 8:114380955-114380977 AACATGGGAACAGTAGACAGTGG - Intergenic
1046474778 8:114728261-114728283 GAGAAGGGAAGAGTAGAGAAAGG + Intergenic
1046712923 8:117533423-117533445 TAGGTGGGTCCAGGAGAGAGAGG - Intronic
1046713060 8:117535074-117535096 TAGGTGGGTCCAGGAGAGAGAGG - Intronic
1047359628 8:124156193-124156215 AAGATGGGAACAGCAGACACTGG - Intergenic
1047397278 8:124512835-124512857 GCGAGGGGAAAAGGAGTGAGGGG + Intronic
1047400521 8:124542464-124542486 GTGATGGTGACAGGAGACAGGGG - Intronic
1047759997 8:127947472-127947494 GGGATGGGCAGAGGAGACAGAGG - Intergenic
1048041982 8:130739513-130739535 GAGATGGGAACAATAGACACTGG + Intergenic
1048042944 8:130748496-130748518 AAAATGTGAAAAGGAGAGAGTGG - Intergenic
1048257204 8:132914032-132914054 GAGATGTGACCAGGGAAGAGGGG - Intronic
1048477277 8:134754935-134754957 GAGATGGGAGATGGAGAAAGCGG + Intergenic
1048519669 8:135141939-135141961 GAGTGGGGAAAGGGAGAGAGAGG + Intergenic
1048871650 8:138804082-138804104 GGGAAGGGAGCAGGAAAGAGAGG - Intronic
1048880996 8:138872430-138872452 GCTGTGGGGACAGGAGAGAGAGG + Intronic
1049032953 8:140050689-140050711 GAGATGGGAGATGGAGAGATGGG + Intronic
1049300743 8:141868100-141868122 GAGTCGGGCACAGGGGAGAGAGG - Intergenic
1049478652 8:142809591-142809613 GAGGCGGGAACTTGAGAGAGAGG + Intergenic
1049844544 8:144793481-144793503 GAGAAGGAGACAGGAGAGGGTGG + Intergenic
1049897397 9:120672-120694 AAGGTGGGAACAGGAGATAACGG + Intergenic
1050342559 9:4654985-4655007 GTGCTGGGAAGAGAAGAGAGTGG - Intronic
1051011479 9:12419507-12419529 GAGAAAGATACAGGAGAGAGTGG - Intergenic
1051363346 9:16301818-16301840 GATAAGGGAACAGAAGAGATAGG + Intergenic
1051528212 9:18071086-18071108 GAGAAAGAAACAGAAGAGAGAGG + Intergenic
1051590957 9:18776697-18776719 GAGATGCAGCCAGGAGAGAGGGG - Intronic
1051983761 9:23057424-23057446 TACATGGGTACAGGATAGAGGGG - Intergenic
1052978881 9:34432678-34432700 GAAATGGGGTCTGGAGAGAGAGG - Intronic
1053098880 9:35352550-35352572 CAGATGGAAACAGGGGACAGGGG + Intronic
1053154225 9:35763957-35763979 GAGATTGAGAAAGGAGAGAGAGG + Intergenic
1054317250 9:63606831-63606853 AAGATGGGAACAAGAGACACTGG + Intergenic
1054770810 9:69081896-69081918 AAGATGGGAACAATAGACAGTGG + Intronic
1054917748 9:70511248-70511270 GAGGCAGGCACAGGAGAGAGAGG + Intergenic
1055148707 9:72967943-72967965 AAGATGGGAACAGTAGACACTGG - Intronic
1055336982 9:75242239-75242261 GAGAGAGAGACAGGAGAGAGAGG - Intergenic
1055454541 9:76460097-76460119 GAGACGGGAAGAGGAGAGGGAGG - Intronic
1055972968 9:81930175-81930197 GCGGTGGGAACAGGATAGAAGGG - Intergenic
1055974721 9:81945247-81945269 GCGGTGGGAACAGGATAGAAGGG - Intergenic
1056188302 9:84159310-84159332 GAGAGGTGCTCAGGAGAGAGAGG + Intergenic
1056632996 9:88308803-88308825 GAGGCGGGAGCAGGAGTGAGGGG - Intergenic
1057167285 9:92939074-92939096 GAGTTGGAAGCATGAGAGAGTGG - Intergenic
1057267369 9:93627835-93627857 GAGATGGGAACATAAGAATGAGG + Intronic
1057358308 9:94350275-94350297 GAGCTGGGGAAAGGAGAAAGGGG - Intergenic
1057478246 9:95423447-95423469 GAGATAGGAACAGGAGGAGGGGG + Intergenic
1057510209 9:95672283-95672305 AAGATGGGAACAGTAGACACTGG + Intergenic
1057649441 9:96907335-96907357 GAGCTGGGGAAAGGAGAAAGGGG + Intronic
1057796148 9:98159578-98159600 GAGATGGGAACAGGAGGTGGGGG - Intronic
1057858189 9:98618682-98618704 CAGATGTCAACTGGAGAGAGAGG - Intronic
1057867774 9:98694743-98694765 GAGATCGGAGAAAGAGAGAGAGG - Intronic
1058070706 9:100598361-100598383 GAGATGGGGACAGGAGAGGTAGG + Intergenic
1058204616 9:102087729-102087751 GATGTGGGTACAGGAGGGAGTGG + Intergenic
1058256906 9:102777941-102777963 GAGCTGGGAAGGGGATAGAGTGG - Intergenic
1058389047 9:104473472-104473494 GTGATGGGGAAAGAAGAGAGAGG - Intergenic
1058419925 9:104823869-104823891 GGGATGGGCACAGAAGAGACTGG + Intronic
1058553706 9:106143249-106143271 CAGAAGGGAAGAGAAGAGAGAGG - Intergenic
1058561583 9:106234584-106234606 GGGGTGGGAACAGGATTGAGTGG - Intergenic
1058722206 9:107774296-107774318 CACATGGCAACAGGAGAGAGTGG + Intergenic
1058964023 9:110019755-110019777 AAGATGGAAACAGTAGAGACTGG + Intronic
1059001142 9:110349974-110349996 AAAATGGGAAGAGGAGAGAAGGG + Intergenic
1059180057 9:112203207-112203229 AAGATGGGAACAGTAGACACTGG - Intergenic
1059526581 9:114996733-114996755 GGGAGGGGTTCAGGAGAGAGAGG - Intergenic
1059542458 9:115144193-115144215 GGGAAGGGAAGAGAAGAGAGGGG - Intronic
1059545125 9:115168177-115168199 GGGATGAGCACAGGAGAAAGAGG + Intronic
1059550411 9:115223491-115223513 GAGAAGGGCAGAGGAGAGAGTGG + Intronic
1059684884 9:116625528-116625550 GAGAAGGCAACATGAGAGTGGGG - Intronic
1059758213 9:117313450-117313472 GAGACAGGAACATGACAGAGAGG + Intronic
1060080628 9:120640881-120640903 AAGATGGGAACAGTAGACACTGG - Intronic
1060185280 9:121560371-121560393 GAGAAAGGAAAAGGAGAGAAGGG + Intergenic
1060202413 9:121659144-121659166 GAGGGGAGAAGAGGAGAGAGTGG + Intronic
1060397214 9:123324768-123324790 GAGCTGGGAAGGGGAGTGAGGGG + Intergenic
1060720611 9:125974490-125974512 GAAATGGAGTCAGGAGAGAGGGG + Intergenic
1060781591 9:126417044-126417066 GACATGGGGACAGGACAGAAAGG - Intronic
1061147543 9:128808719-128808741 GGGATGGGAACAGGAGGCAAAGG - Exonic
1061181885 9:129029327-129029349 GAAATGGGAATGGGAGGGAGGGG - Intergenic
1061250991 9:129426280-129426302 GAGGTGGGAACAGGAGCTGGTGG + Intergenic
1061262377 9:129487431-129487453 GGGATGGGGAGAGGACAGAGAGG + Intergenic
1061840643 9:133356771-133356793 GAGGGGAGAGCAGGAGAGAGGGG + Intronic
1061845779 9:133387261-133387283 GGAATGGGGAGAGGAGAGAGAGG + Intronic
1061883266 9:133578491-133578513 GAGACGGGTAGGGGAGAGAGAGG + Exonic
1062126238 9:134864483-134864505 GGGTTGGGAAATGGAGAGAGAGG + Intergenic
1062357402 9:136171303-136171325 GAGGTGGGAAGAGACGAGAGAGG - Intergenic
1062561705 9:137144962-137144984 GGGGTGGGGACAGGAGTGAGAGG + Intronic
1062561725 9:137145019-137145041 GGGGTGGGGACAGGAGTGAGAGG + Intronic
1062561812 9:137145247-137145269 GGGGTGGGGACAGGAGTGAGAGG + Intronic
1062561832 9:137145304-137145326 GGGGTGGGGACAGGAGTGAGAGG + Intronic
1185490896 X:516230-516252 GAGAGAGGAAGAGGAGAGACGGG - Intergenic
1185679124 X:1873880-1873902 GAGGAGGGAAAAAGAGAGAGAGG - Intergenic
1185688313 X:1948391-1948413 GAGAGGGGAGGAGGAGGGAGGGG + Intergenic
1185688591 X:2133913-2133935 GAGAGGGGAGGAGGAGGGAGGGG + Intergenic
1185814976 X:3146276-3146298 GAGAGAGGAAAAGGAGAGGGAGG - Intergenic
1185825390 X:3244304-3244326 GAGAGGAGAAAAGGAGAGAGAGG + Intergenic
1185929808 X:4189792-4189814 GAGATGGGAGCAGCAGACAGAGG + Intergenic
1185965940 X:4602831-4602853 GAGATGGGAAGGAGAGAGATTGG - Intergenic
1186021175 X:5257091-5257113 GAGAGGAAATCAGGAGAGAGAGG + Intergenic
1186442877 X:9601184-9601206 GAGATGGGAGCTGGAAAAAGGGG - Intronic
1186484702 X:9925100-9925122 GAGGTGGAAAAAGGAGACAGTGG - Intronic
1186518584 X:10185985-10186007 GAGAGGGGATCAGGATGGAGAGG + Intronic
1186669615 X:11756588-11756610 GAGATGAGAACAGTAGATGGTGG - Intergenic
1187447718 X:19373287-19373309 GAGAAGGGAAGAGGAGAGGTGGG + Intronic
1188053455 X:25514194-25514216 GAGATGATAACAGGAGACACTGG + Intergenic
1188642811 X:32527510-32527532 GAAAGGGGAAGAGTAGAGAGAGG - Intronic
1188697711 X:33216413-33216435 AAGATGGGAACAAGAGATACTGG + Intronic
1188744086 X:33820427-33820449 GAGAGGGGAGCAAGAGTGAGGGG - Intergenic
1188955825 X:36434209-36434231 GAGAAGGGAAGGGAAGAGAGGGG + Intergenic
1189016908 X:37294500-37294522 GAGAGAGGAAGAAGAGAGAGAGG + Intergenic
1189110094 X:38280434-38280456 GCCATGGGAACTGGGGAGAGGGG + Intronic
1189363211 X:40369108-40369130 GAGAGGGAACCAGGAGATAGGGG + Intergenic
1189399554 X:40654280-40654302 GAGAAGAGAAGAGGAGAAAGGGG + Intronic
1189624730 X:42884284-42884306 AAGATGGGAACAGTAGACACTGG - Intergenic
1189642461 X:43087530-43087552 GAATGGGGAACATGAGAGAGAGG - Intergenic
1189860022 X:45262462-45262484 GAGAAGAGAGCAAGAGAGAGGGG + Intergenic
1189989051 X:46577509-46577531 GAGAAGGGAGGAGAAGAGAGGGG + Intronic
1190112789 X:47605577-47605599 GAGAAGGGAACAGGTAGGAGAGG - Intronic
1190259790 X:48790672-48790694 GAGATGGGAAGAAGAGAGACGGG + Intronic
1190266558 X:48830700-48830722 GGGAAGAGAAAAGGAGAGAGCGG - Intergenic
1190290801 X:48990964-48990986 GAAATGGGAAATGGAGAAAGAGG - Exonic
1190328065 X:49218795-49218817 GGGATGGGGACAGGAGAGGTGGG + Intronic
1190427357 X:50345720-50345742 GAGATGGCATGAGGAGAGAAAGG + Intronic
1190446801 X:50533828-50533850 GAGATGGCAAGAGTAGAGAGAGG + Intergenic
1190536848 X:51437478-51437500 GAGATGGGAGCTAGATAGAGAGG + Intergenic
1191104290 X:56763030-56763052 GCAAAGGGAACAGGAGACAGGGG + Intergenic
1191157483 X:57289842-57289864 GAGAAGGGAATAAGGGAGAGAGG + Intronic
1191884477 X:65874515-65874537 GAGAGGGGAAGAGGTGAGACTGG + Intergenic
1192830863 X:74749642-74749664 GAGAAGGGAAGAGTACAGAGAGG - Intronic
1193926839 X:87497719-87497741 GAGATGGGAACAGTAGATGCCGG - Intergenic
1194083006 X:89490932-89490954 TAGATTGGTACAGCAGAGAGTGG - Intergenic
1194279007 X:91923859-91923881 AAGATGGGAACAGTAGACACTGG + Intronic
1194846551 X:98816483-98816505 AAAGTGGGAACAGGAAAGAGAGG + Intergenic
1194920732 X:99760936-99760958 TACATGGTAGCAGGAGAGAGAGG - Intergenic
1194942445 X:100027270-100027292 GAGAGGGGAAGAAGAAAGAGAGG + Intergenic
1195133452 X:101877950-101877972 GAGATGGGGACAGAAGCTAGGGG + Intergenic
1195145813 X:102016285-102016307 GAGAAGGGAAAATCAGAGAGAGG - Intergenic
1195162571 X:102185039-102185061 GCCATGGCAACAGGAGAGAAAGG + Intergenic
1195390156 X:104353192-104353214 TAGATGGGATGAGGAGAGATGGG + Intergenic
1196084116 X:111665799-111665821 AAAATGTGAAAAGGAGAGAGTGG + Intronic
1196374144 X:115013160-115013182 GAGATTGGAAGGGGAGAGATTGG + Intronic
1196599692 X:117587528-117587550 CATATGGTAGCAGGAGAGAGAGG - Intergenic
1196693597 X:118586821-118586843 GTGATGGGAACAGTGGAGATAGG + Intronic
1196869024 X:120095820-120095842 GAGTTGGGAATAGGAGAGGTGGG - Intergenic
1197532306 X:127644673-127644695 GGGAGGGGAGTAGGAGAGAGAGG + Intergenic
1197644567 X:129003953-129003975 GAGATGATAAGAGGAGAAAGGGG - Intergenic
1197728594 X:129792585-129792607 GAGAAGGGAGCAAGGGAGAGAGG - Intronic
1197898085 X:131338814-131338836 AAGATGGGAACAAGAGACACTGG + Intronic
1198075258 X:133187943-133187965 GAAATGGGGAGAGGAGAGAAGGG - Intergenic
1198383388 X:136105113-136105135 GAGGAAGGAAGAGGAGAGAGAGG + Intergenic
1198495242 X:137185694-137185716 GAAAGAGGACCAGGAGAGAGTGG + Intergenic
1198721677 X:139628437-139628459 AAGATGGGAACAATAGACAGTGG + Intronic
1198838001 X:140824934-140824956 AAGATGGGAACAAGAGACACTGG - Intergenic
1198914860 X:141658693-141658715 TAGATGGGGAAAGGAGGGAGGGG + Intronic
1199386883 X:147233205-147233227 GGGAGGGGAAGAGGAGAAAGGGG - Intergenic
1199474504 X:148230955-148230977 GAGAGGGGAGAAGGAGAGGGAGG - Intergenic
1199771085 X:150975838-150975860 GGGAAGGGAGCAGAAGAGAGGGG - Intergenic
1199895135 X:152119987-152120009 GGGATGGGAATAGGGAAGAGGGG + Intergenic
1200078836 X:153565709-153565731 GAGATGGGAACAAGGGAGCATGG - Intronic
1200281727 X:154782472-154782494 GAGATGGCCCCAGGAGTGAGTGG - Intronic
1200435658 Y:3146806-3146828 TAGATTGGTACAGCAGAGAGTGG - Intergenic
1201065572 Y:10091924-10091946 GAGAAGGGGGGAGGAGAGAGAGG + Intergenic
1201253806 Y:12087726-12087748 GAGAGGAGAAAAGGAAAGAGAGG - Intergenic
1201286411 Y:12382426-12382448 GAGATGGACACAGGAGTTAGGGG + Intergenic
1201557503 Y:15279397-15279419 CACATGGCAACAGGAAAGAGAGG + Intergenic
1201617617 Y:15919069-15919091 AAGATGGGAACAGTAGACACTGG + Intergenic
1201701059 Y:16882696-16882718 GAGAGAGAAAGAGGAGAGAGAGG + Intergenic
1201749682 Y:17419346-17419368 GGGATGGGGACGGGAGACAGGGG + Intergenic
1201859936 Y:18585706-18585728 GAGATGGGGGGTGGAGAGAGAGG - Intronic
1201873385 Y:18734675-18734697 GAGATGGGGGGTGGAGAGAGAGG + Intronic
1202598666 Y:26570207-26570229 GCAATGAGAACAGGAGAGATGGG - Intergenic