ID: 1153747642

View in Genome Browser
Species Human (GRCh38)
Location 18:8196406-8196428
Sequence AGCAGTGTTTACCTCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153747637_1153747642 26 Left 1153747637 18:8196357-8196379 CCTTAGTGCTATTACTGTTAGAG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1153747642 18:8196406-8196428 AGCAGTGTTTACCTCCTTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153747642 Original CRISPR AGCAGTGTTTACCTCCTTGA AGG Intronic
901470675 1:9454354-9454376 AGCAGCGCTTGCATCCTTGAGGG - Intergenic
902401480 1:16159983-16160005 AGCAGTGGCCACCTCCCTGAAGG - Intergenic
903867363 1:26409570-26409592 AGCCGTCTTTATCTCCTAGAAGG + Intergenic
907372734 1:54013768-54013790 AACAGTTATTAGCTCCTTGAAGG + Intronic
908095763 1:60736108-60736130 AGCATTTTTTACCTCCATTATGG - Intergenic
910010774 1:82458921-82458943 AGGATTTTTTACCTCCTTGAGGG + Intergenic
912118709 1:106440779-106440801 AGCAGTGTTTATCAAGTTGAAGG - Intergenic
912562883 1:110562915-110562937 CTCAGTTTCTACCTCCTTGAAGG - Intergenic
919774689 1:201186737-201186759 AGAAGTGGTTTCCTCCTGGAAGG - Intergenic
919789354 1:201280556-201280578 AGGAGTGTTAGCCTCCTTGCTGG + Intergenic
924725283 1:246663858-246663880 AACAGTGTTTACCTCTGGGATGG + Intronic
1063277233 10:4583251-4583273 AGCAGCGTTTACCTTCATAAGGG - Intergenic
1063595027 10:7427119-7427141 AACAGTGATTACCTTCTGGAAGG - Intergenic
1066277951 10:33887275-33887297 AGCAGTGTTCTCTTTCTTGATGG + Intergenic
1066349295 10:34622512-34622534 AGAAGTTATTCCCTCCTTGATGG + Intronic
1072847245 10:98845369-98845391 AGCAGTGATGACATCCTTGATGG + Intronic
1073566802 10:104542151-104542173 ATCAGTTTTCACCTCCATGAAGG - Intergenic
1073626107 10:105098926-105098948 AGCATTATCTGCCTCCTTGATGG - Intronic
1074205395 10:111278599-111278621 GGCAGTTTTTACTTCCTTGCTGG - Intergenic
1076142385 10:128089952-128089974 GGCAGTGCTGACCTCCTTGGGGG - Intergenic
1076751965 10:132547719-132547741 AGCAGGGTTTTCCTCCTTCACGG + Intronic
1076868311 10:133180216-133180238 AGTTGTGTTTCCCTCCTTCAGGG + Intronic
1078202528 11:9196473-9196495 AACAGTGGTAACCTCCCTGAAGG + Intronic
1078619059 11:12891184-12891206 AGCAGTGGCTACCTACTTAAGGG - Intronic
1079970180 11:27027180-27027202 TGCAGTCCCTACCTCCTTGAAGG + Intergenic
1080236163 11:30070786-30070808 AGGAGTGTTCACCTCCATGTGGG - Intergenic
1084595379 11:70113633-70113655 AGCAGGGATTACCTGCTTAAAGG - Intronic
1085974631 11:81637209-81637231 TGCAGTATTTACCTCCTTTGGGG + Intergenic
1094286006 12:28794425-28794447 AGCCGTGTTTAGATTCTTGACGG + Intergenic
1098152575 12:67562229-67562251 ACCATTATTTACCTCTTTGATGG + Intergenic
1100857495 12:98771005-98771027 AGCAATTTGTACCACCTTGAGGG + Intronic
1102206666 12:111095641-111095663 AGCAGTGCTCCCCTCCTTGAGGG + Intronic
1102733344 12:115134700-115134722 AGCAGTTTCTGCCTCTTTGAAGG - Intergenic
1107318861 13:39164782-39164804 AACAGTGGTTATCTCCGTGAGGG + Intergenic
1108663504 13:52606930-52606952 AGCTGTGATTAACTCCTTGCTGG + Intergenic
1110312210 13:74063405-74063427 AGCAGTTTTGATGTCCTTGAAGG - Intronic
1112432283 13:99360577-99360599 AGCATTGCTTTGCTCCTTGAAGG + Intronic
1113669686 13:112167208-112167230 AACAGTGTTTTCCTCATAGATGG + Intergenic
1114176125 14:20321917-20321939 TGCTGTGTTTACATCCATGATGG - Intronic
1114417016 14:22551695-22551717 AGCAGCTTTCACCTCCTTGGGGG - Intergenic
1117189679 14:53277783-53277805 AGGAGTGTTCACCTTCTTTATGG + Intergenic
1118780510 14:69004710-69004732 AGCCGTAATTGCCTCCTTGAAGG - Intergenic
1120452733 14:84690223-84690245 AGCATGGTTTATCTACTTGATGG + Intergenic
1122342272 14:101036105-101036127 AGCACTGAGTGCCTCCTTGAAGG + Intergenic
1123995224 15:25713503-25713525 ATCAGTGTTTGCCTGTTTGAAGG - Intronic
1124229576 15:27932163-27932185 AGCAGGGTTCACCTCCTTTGTGG - Intronic
1125416044 15:39453620-39453642 ACCAGTGTTCACCTTCATGAAGG - Intergenic
1126444530 15:48727465-48727487 AGCAGACTTTAGGTCCTTGATGG + Intronic
1129127369 15:73454321-73454343 AGCAGTGTGAACGTCCTTAATGG + Intronic
1130007663 15:80116236-80116258 ATCAGTGTTTTCTCCCTTGAGGG + Intronic
1132576456 16:666588-666610 AGCATGGTTTACCTCCGTGGTGG - Exonic
1134173024 16:11983884-11983906 ACCAGTGTTCACCCCCTTGGGGG - Intronic
1134838890 16:17385042-17385064 AGCAGCTTTTACCTCCTTCAAGG - Intronic
1134858296 16:17538709-17538731 ACCAGTGATTACCTCCTGGGAGG - Intergenic
1135157755 16:20068102-20068124 AACAGTGGTTACCTCTGTGATGG + Intronic
1135426846 16:22345041-22345063 AGCAGTTTTTACCTTGTTAATGG - Intergenic
1138320379 16:56106191-56106213 GGCAATATCTACCTCCTTGATGG - Intergenic
1141103258 16:81213150-81213172 AGGAGTTTTTACCTCCTAGCAGG + Intergenic
1141600690 16:85124332-85124354 AGCAGTGTCTCCTTCCTGGACGG - Intergenic
1142072042 16:88096403-88096425 AGCATTGTGTGCCACCTTGAGGG - Intronic
1142583726 17:957725-957747 AGGAGGTTTGACCTCCTTGACGG - Intronic
1143731917 17:8886346-8886368 ATCAGTGTGAACCTCCTGGAGGG + Intronic
1144501082 17:15786929-15786951 GGCAGTGTTGTCCTCGTTGAAGG - Intergenic
1145163249 17:20589603-20589625 GGCAGTGTTGTCCTCGTTGAAGG - Intergenic
1148075911 17:44935124-44935146 AGCAGTATCTATCTCCTTGAGGG + Intronic
1153747642 18:8196406-8196428 AGCAGTGTTTACCTCCTTGAAGG + Intronic
1157133771 18:45034220-45034242 AGCATTGTTTACTACCTTAAGGG - Intronic
1157730636 18:50001243-50001265 AGAAGGCTTTACCTCCATGATGG + Exonic
1159064734 18:63557276-63557298 ATCAGTGTTTATCTCCTATACGG + Intronic
1159276440 18:66227757-66227779 AGGAGTGTTTACCTTCGTGGTGG + Intergenic
1159664388 18:71140255-71140277 AGCAGGGTAGACCTCATTGAGGG - Intergenic
1164766190 19:30773368-30773390 AGAAGTGTTTCCCTCCTTCATGG + Intergenic
1164781417 19:30896625-30896647 ACCAGGGGTTACCTCCATGAAGG + Intergenic
1168222418 19:54970143-54970165 AGCCTTGTCTACCTCCTTGTGGG - Exonic
1168714416 19:58518668-58518690 ATCACGGTTTACCTGCTTGATGG - Intronic
927069145 2:19507635-19507657 AGCAGTGTCTTCCCCCATGAAGG + Intergenic
928243537 2:29607225-29607247 AGTAGTGCTTTCCTCCTTGACGG + Intronic
928306913 2:30177892-30177914 TGGAGTGTTTCCCTCCTGGAGGG + Intergenic
928398808 2:30963525-30963547 AACAGTGTTTATGTCCTCGAGGG - Intronic
930189418 2:48442154-48442176 AGGAGTGTTTCCTTGCTTGAAGG + Intronic
931633733 2:64323603-64323625 AGGAGGGTTTCCTTCCTTGATGG + Intergenic
932608316 2:73178739-73178761 AGCAGCCCTTACCTCCTTCAGGG + Intergenic
933331589 2:80899112-80899134 AACAGTGTTTGCCTTCTTTAGGG + Intergenic
943122316 2:183752051-183752073 AGCAAAGTTTTCCACCTTGATGG - Intergenic
1168860262 20:1041167-1041189 AGCAGTGATGACTTCCATGAAGG - Intergenic
1169764559 20:9134956-9134978 AGCAGTGCTTACCTACTCAATGG - Intronic
1171239504 20:23553609-23553631 AGCAGTCTGTACCTCCCTGAGGG + Intergenic
1172530710 20:35629423-35629445 AGCCTTGTTTGCCTCCTTGCAGG - Intronic
1173016966 20:39234601-39234623 CACAGTGTTTCCCTCCTTGAAGG + Intergenic
1173271266 20:41537822-41537844 AACTGTGTTTAACTTCTTGAAGG - Intronic
1173603682 20:44313915-44313937 AGCAGTCTTTCCCTCCTTCTTGG - Intergenic
1174691385 20:52510113-52510135 ACCAATGTCTCCCTCCTTGAAGG + Intergenic
1182340752 22:29618939-29618961 TCCAGAGTTTACATCCTTGAAGG - Intronic
1182965062 22:34513342-34513364 AGCAGTGTTTACCTCATTTCAGG - Intergenic
1183504746 22:38202748-38202770 AGCAGTGTGTACCTCGGAGAGGG + Intronic
953099034 3:39808217-39808239 ACCAGTGTGTACCTCCCTCAAGG - Intergenic
956944289 3:74201674-74201696 AGCAGATTTTACTTCCTTAATGG + Intergenic
964255416 3:154769845-154769867 GGCTGTGTTTACTTCATTGATGG + Intergenic
964798431 3:160525926-160525948 AAAAGTGTTTACCTCCTGAATGG + Exonic
969915229 4:10484360-10484382 AGCAGTGACTACCTGTTTGAAGG - Intergenic
973004631 4:44992058-44992080 AGCAGTGTTTAGCTGCCTAAAGG - Intergenic
973826115 4:54708974-54708996 AGCAGTGTGGACCTCGCTGAGGG + Intronic
981111813 4:140943391-140943413 AGCAGTAGTTACCTGCATGAAGG + Intronic
984398310 4:179228520-179228542 AGCAGTGCCTGCCTCCTCGAAGG + Intergenic
985791074 5:1927022-1927044 AGCAGTGTTTTCATCCTTTTGGG + Intergenic
986033069 5:3911267-3911289 ACCAGTGTGCACCTCCTGGAGGG - Intergenic
988352174 5:30123341-30123363 AGCAATGTTTACCTCTGTGGGGG - Intergenic
990301109 5:54450433-54450455 ACCAATTTTTACCTCCTTGTGGG + Intergenic
990433519 5:55762904-55762926 AGCAGAATTTTCCTGCTTGAAGG + Intronic
992409891 5:76495012-76495034 ACCAATGTTTACCTCCTGCAGGG - Intronic
992489992 5:77233412-77233434 AGCAGGTTTTCTCTCCTTGAGGG - Intronic
994066379 5:95547124-95547146 AGCAGTCTTCACTTCCTTGCTGG + Exonic
994111411 5:96008755-96008777 AGCATTGTTTTCCTCCATGTAGG - Intergenic
995636061 5:114192208-114192230 TTCCGTGTCTACCTCCTTGAGGG + Intergenic
996702321 5:126462819-126462841 AGCACTGGTTCTCTCCTTGAAGG - Intronic
997700950 5:135899073-135899095 AACAGTGTTTACCTTTTTAAGGG + Intergenic
999066196 5:148687952-148687974 GGCATTTTTTTCCTCCTTGAGGG - Intergenic
1003565234 6:7216805-7216827 GGCAGTCTTCCCCTCCTTGAGGG - Intronic
1004571328 6:16848459-16848481 AGCAGTGCTTAACCCATTGAAGG + Intergenic
1005328411 6:24724299-24724321 AGCAGTGTTTTCGTCCTCCAGGG - Intergenic
1011659359 6:89581037-89581059 CTCAGTGTTTCCCTCCCTGAAGG + Intronic
1012818507 6:104055034-104055056 AGCTGTGTGTAACTCCCTGAAGG - Intergenic
1015340826 6:132098522-132098544 AGCAGTTTTTACCTTCTAGATGG + Intergenic
1016675393 6:146760269-146760291 AACAGTGATTGCCTCTTTGAGGG - Intronic
1016850158 6:148610895-148610917 ATCAGTGTTTACCACGTTCAGGG - Intergenic
1018044247 6:159952028-159952050 AGCAGTGTTTAACTCCCAGCAGG - Intergenic
1018420318 6:163635187-163635209 AGGAGTGTGTGCCTCCCTGAAGG + Intergenic
1019009350 6:168829655-168829677 AGCAGTGTTTGCCCACTTGTAGG + Intergenic
1027401207 7:77809621-77809643 AGAAGTGTTTATTTCCTTAAGGG + Intronic
1031220745 7:118962147-118962169 AGAAGTCTTTTCCTCTTTGAAGG - Intergenic
1034047247 7:147942711-147942733 AGCAGTCTTCACATACTTGAAGG - Intronic
1035658182 8:1327177-1327199 AGCAGTGTTAACGTCCTAAATGG - Intergenic
1038961504 8:32525231-32525253 AGCAATGCTGTCCTCCTTGATGG + Intronic
1039069540 8:33636996-33637018 AGAGATGTTTAGCTCCTTGAGGG + Intergenic
1039226069 8:35389686-35389708 ACCATAGTTTACCTCCTTAATGG + Intronic
1041617621 8:59926516-59926538 AGTAGTGTTTTCCTCCTGGCTGG - Intergenic
1042116904 8:65442285-65442307 ATCAGGGTTTGCCTCCTTGGAGG + Intergenic
1042969599 8:74393871-74393893 AACAGTGTCTACCACCTTCAGGG - Intronic
1046621793 8:116535952-116535974 ATTACTGTTTACCTCCTCGAAGG - Intergenic
1047571504 8:126103597-126103619 AGAATTGTTTACCTCCCTAAGGG + Intergenic
1048699209 8:137069059-137069081 AGCATTATTTACCACCTTGTAGG + Intergenic
1051535941 9:18157821-18157843 AGCAGTGTTATACTCCCTGAAGG - Intergenic
1052130346 9:24838369-24838391 AACAGTGTTTAGCTTCTTCAGGG - Intergenic
1054883040 9:70165072-70165094 AGCAGTGTTTATTTCATTGTAGG - Intronic
1055567347 9:77582395-77582417 AGCAGGGTTTACCTGCCTGGTGG - Intronic
1058906417 9:109485789-109485811 TGCAGTGTGTACCTCTTTAAAGG + Intronic
1059316355 9:113429032-113429054 AGGATAGTTTACCTCCCTGAAGG + Intronic
1060074023 9:120575731-120575753 AACAGTGATTACCTCCTAGGCGG - Intronic
1185760191 X:2684637-2684659 ATCTGTGTCCACCTCCTTGATGG + Intergenic
1187009277 X:15263890-15263912 AACAGTGATTACCTGCTTGGTGG + Intronic
1188776750 X:34229503-34229525 AGCAGGATTTACCTCTTTAAAGG - Intergenic
1190655494 X:52608576-52608598 ACCAGTGTTCACATCCATGAAGG + Intergenic
1190657909 X:52628339-52628361 ATCAGTGTTCACATCCATGAAGG - Intergenic
1191212666 X:57905159-57905181 AGCAATGATTAACTCCCTGATGG - Intergenic
1199666455 X:150100068-150100090 AGCAGGGTTGGCCTCCTTGCTGG - Intergenic