ID: 1153748236

View in Genome Browser
Species Human (GRCh38)
Location 18:8202347-8202369
Sequence AAGTGGTGCTAGAAAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153748233_1153748236 6 Left 1153748233 18:8202318-8202340 CCTATTTTACAGTAAATAGACAT 0: 1
1: 0
2: 1
3: 42
4: 355
Right 1153748236 18:8202347-8202369 AAGTGGTGCTAGAAAGAAGAGGG 0: 1
1: 0
2: 2
3: 38
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153748236 Original CRISPR AAGTGGTGCTAGAAAGAAGA GGG Intronic
901929703 1:12589148-12589170 ATGGGGTGCTAGATAGCAGAGGG + Intronic
902161241 1:14532088-14532110 AAGTGGTGCAAGAAGGAAGGTGG + Intergenic
902708615 1:18223416-18223438 AAGAAGTGGTAGAAAGAAGTTGG + Intronic
904443457 1:30548813-30548835 AAGTGAGCCTAGAAAGTAGAAGG - Intergenic
904819324 1:33230809-33230831 TGGTGGTGCTAGAAATAGGAAGG + Intergenic
905308974 1:37036657-37036679 AAGTGGTGCTAGAAACGCGAAGG + Intergenic
905692531 1:39954154-39954176 ATGTGGTCCTCAAAAGAAGATGG - Intergenic
905961375 1:42045231-42045253 AGGTCGTGCTAGGAAGGAGACGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906808530 1:48803180-48803202 AAGAGCTGTTTGAAAGAAGAGGG - Intronic
906940711 1:50252782-50252804 AAGTTGTGCTGGAAAGAACAAGG + Intergenic
907857324 1:58316581-58316603 GAGTAGTGCTAGGGAGAAGAGGG + Intronic
908262005 1:62346333-62346355 AAGTGGTGGTATTAAGAAGTGGG + Intergenic
908743596 1:67354233-67354255 AAGTGGTGCTAGCCAGGTGAGGG + Intronic
908970470 1:69822578-69822600 AAGTGGGGCAAGAAAGAGGTAGG + Intronic
909213008 1:72848119-72848141 AAGTGTTACTAGAGAGGAGAGGG + Intergenic
912654950 1:111477700-111477722 CCATGGTGCCAGAAAGAAGAGGG - Exonic
913098421 1:115541132-115541154 AACAGGACCTAGAAAGAAGAGGG + Intergenic
915232324 1:154454895-154454917 AATTGGTCTGAGAAAGAAGAGGG + Intronic
916557130 1:165902900-165902922 AAATGTTGCTTGAAACAAGAAGG + Intronic
916683166 1:167122318-167122340 AAGTAGAGAGAGAAAGAAGAGGG - Intronic
917365363 1:174225831-174225853 AAGTGGTGAGAGAAAAGAGAGGG + Intronic
918183976 1:182111125-182111147 AAGTGGAGGTAGAAAGTGGATGG + Intergenic
918248575 1:182681866-182681888 AAAAGGTTCTAGAAGGAAGAGGG - Intronic
918289092 1:183089053-183089075 AAGAGGAGTTAGGAAGAAGATGG - Intronic
918768732 1:188523869-188523891 AAGGTGTAGTAGAAAGAAGAAGG + Intergenic
919404334 1:197158990-197159012 AAGAAGGGCTAGGAAGAAGAAGG + Exonic
919516653 1:198533445-198533467 TAGTGGAGTTAGCAAGAAGAGGG + Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
920976644 1:210792066-210792088 AAGTGGAGGAGGAAAGAAGATGG - Intronic
921944518 1:220877618-220877640 AAGTGGCACTAGAAAGCAGAGGG + Intergenic
922046607 1:221951392-221951414 AAGAGGGGCTGCAAAGAAGAAGG - Intergenic
922876458 1:228943390-228943412 AAGGGGAGCTAGAAAGCAGATGG - Intergenic
923075412 1:230604684-230604706 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
923388893 1:233493897-233493919 ATGAGGAACTAGAAAGAAGATGG - Intergenic
924450388 1:244173646-244173668 AAGTGGTGCAAATAATAAGAAGG - Intergenic
1063327808 10:5122353-5122375 AAGTGGTGCAGAATAGAAGAGGG - Intronic
1064453593 10:15466157-15466179 AAGTGCTGTTTTAAAGAAGATGG - Intergenic
1065185589 10:23167892-23167914 AACTAGTGATAGAAAAAAGATGG - Intergenic
1065909256 10:30287147-30287169 AAGGGGAGCTGGAAAGGAGATGG + Intergenic
1066183198 10:32983336-32983358 AAGAGGTGTTAGGAAGGAGAAGG - Intronic
1067373662 10:45707734-45707756 AAGTGGAGATACAAAGGAGAAGG - Intergenic
1067881485 10:50049505-50049527 AAGTGGAGATACAAAGGAGAAGG - Intergenic
1067887726 10:50105148-50105170 AAGTGGAGATACAAAGGAGAAGG + Intronic
1071015576 10:80993567-80993589 AAGTGCTATTAGAAATAAGATGG - Intergenic
1072095125 10:92170861-92170883 TAGTGGTGGTTCAAAGAAGATGG - Intronic
1072272364 10:93789275-93789297 GAATGGTGCTAGAAAGGAAAAGG + Intronic
1073244701 10:102081496-102081518 AGCTGGGACTAGAAAGAAGATGG + Intergenic
1073713966 10:106080631-106080653 AAGTGGTGATATAAAGAACAGGG + Intergenic
1074288455 10:112120287-112120309 AAGTGGTGCCAGAAAAACAAAGG + Intergenic
1074909550 10:117895326-117895348 AAGTGGTGCTGATAGGAAGAGGG + Intergenic
1075017613 10:118921832-118921854 TAGTGGGCCTAGAAAGAACAAGG + Intergenic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1078439135 11:11349880-11349902 AAGTGTTGATTGCAAGAAGAGGG - Intronic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1079498831 11:21077841-21077863 AAGTTGTCTTAGAAAGCAGAGGG + Intronic
1079911423 11:26315331-26315353 GAGTGCTGCCAGAAACAAGATGG - Intronic
1079930050 11:26547119-26547141 AAGGGATGCTAGTAGGAAGATGG + Intronic
1079950001 11:26790255-26790277 AAGTCTAGGTAGAAAGAAGATGG + Intergenic
1080638414 11:34143399-34143421 AAAGCCTGCTAGAAAGAAGAGGG - Intronic
1080909141 11:36577766-36577788 AATTTGTGGTGGAAAGAAGAAGG - Exonic
1081518373 11:43856752-43856774 TAGTGGTGGTAGATAGAGGAGGG + Intergenic
1081533802 11:43983012-43983034 AAGGGGTGCAAGACAGAGGAGGG + Intergenic
1086550911 11:88050587-88050609 AAGTTTTACTAGAAAGAATAAGG + Intergenic
1086894749 11:92299034-92299056 GAGTGGAGCTACACAGAAGAGGG + Intergenic
1087362315 11:97176552-97176574 AGGTGAAGATAGAAAGAAGATGG - Intergenic
1087420046 11:97911132-97911154 AATTGGTAATAGAAAGAAAATGG + Intergenic
1088806798 11:113359839-113359861 TGGTGGTGCTAAAAAGGAGACGG + Intronic
1088959378 11:114647348-114647370 AAGTTGTTCTAGAAAGTAAAGGG - Intergenic
1089156182 11:116404525-116404547 AGGTGGTGCTAGGAAGAAAGAGG + Intergenic
1089910551 11:122095627-122095649 AAGTGGTTTTAGAAAGAGGGTGG + Intergenic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1092783077 12:12005213-12005235 AAGTGGGACTTGAAAGCAGAAGG - Intergenic
1092924650 12:13262213-13262235 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
1093447549 12:19277767-19277789 AAGTTCTGATAGAAAGAAAAAGG + Intronic
1093711106 12:22330963-22330985 ATGTGGTGATAGAAAGATAAAGG - Intronic
1093896202 12:24577194-24577216 TATTGGTGGTAGAAGGAAGATGG - Intergenic
1094027485 12:25974247-25974269 AGGAGGTGAAAGAAAGAAGAGGG + Intronic
1096604997 12:52758369-52758391 AAGTTGTGCCAGAATGAAGCTGG - Intergenic
1097017037 12:55994444-55994466 AAGAGGTGGTAGGAAGTAGAGGG - Exonic
1097335319 12:58376406-58376428 AAATAATGGTAGAAAGAAGACGG - Intergenic
1097750918 12:63351610-63351632 AAGTTGTCCTAGAATGAAGGGGG + Intergenic
1098154679 12:67585360-67585382 AAGTGGTTCTGACAAGAAGACGG + Intergenic
1098462805 12:70751414-70751436 AAGTGGTGGTGGACAGAGGATGG - Intronic
1098765988 12:74489498-74489520 AAGTGGTGATATAAAGACTAGGG - Intergenic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1099872993 12:88371142-88371164 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1100161667 12:91867777-91867799 CAGTGGTTCTAGAATCAAGAAGG - Intergenic
1101051691 12:100870166-100870188 AAGGGTTGCTGGAAAGAAGCTGG + Intronic
1101072384 12:101089417-101089439 AAGTGGAGATTGAAAGTAGATGG + Intronic
1102201311 12:111059729-111059751 AAGGGGTGCTACCAAGGAGAAGG + Intronic
1103826790 12:123745410-123745432 AAGTGTTAATAGAAAGAAAATGG + Intronic
1104236300 12:126940998-126941020 AAGTAGTGCAAAAAAGAAGATGG + Intergenic
1104469572 12:129018678-129018700 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
1105032429 12:132893174-132893196 AGGAGGGGCTACAAAGAAGAAGG - Intronic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106893416 13:34271265-34271287 ATGTGGTGCGAGAAAGACAAAGG + Intergenic
1108104850 13:46997833-46997855 ATGAGGAGCTAGAAAGAGGACGG + Intergenic
1108475023 13:50807412-50807434 AACTGGTGCTTGAGAGAAGCAGG - Intronic
1109343776 13:61091823-61091845 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112416445 13:99207012-99207034 GAGTGGTGCTAGAAAAGACAGGG - Intronic
1112597723 13:100824054-100824076 AAGTGGTGATGGAAAGAGAATGG - Intergenic
1112683970 13:101801610-101801632 AAGTGGTAATAGAAAGAAGTGGG + Intronic
1113324527 13:109268806-109268828 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1113352573 13:109543844-109543866 AAGTGGTACTAGGCAGGAGATGG - Intergenic
1114345450 14:21789816-21789838 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
1114892306 14:26941208-26941230 AGGTGATGCTGGAAAGAATAAGG - Intergenic
1115287442 14:31731275-31731297 AAGGGGAGCTCCAAAGAAGATGG + Intronic
1115957483 14:38797656-38797678 AGGTAGTGCTAGCAAAAAGAAGG + Intergenic
1117077142 14:52116098-52116120 CAGTGGTTCTAGAGAGATGAGGG - Intergenic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1119212185 14:72840272-72840294 GAGTGGTTCTAGTAAGAACAAGG - Intronic
1119562674 14:75603457-75603479 AAGGGGAGCTGGAAAGCAGATGG - Intronic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120614691 14:86688814-86688836 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
1121086772 14:91152575-91152597 AAGTGTTGCTGCAAGGAAGAAGG - Intronic
1121303828 14:92892462-92892484 CTGTGGGGCTAGAAATAAGACGG - Intergenic
1121391041 14:93574815-93574837 AAGTGTTAATAGAAAGAACATGG + Intronic
1125378421 15:39059516-39059538 AAGTGTTCCTAGAAAGATTAAGG - Intergenic
1125914344 15:43472677-43472699 ACGTGTTGCTAGAAACAAGTAGG + Intronic
1126243949 15:46481327-46481349 AAGAAGTGTTAGAAAAAAGAGGG - Intergenic
1126843949 15:52742045-52742067 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1127845974 15:62871340-62871362 AAGAGGTGAGAGAAAGAGGAAGG + Intergenic
1128213559 15:65918454-65918476 AAGTGGTAATAGAAAGCAGAAGG - Intronic
1128666000 15:69538820-69538842 AGGTGGTGTCACAAAGAAGAGGG + Intergenic
1129344394 15:74907343-74907365 AATTGGTGTTGGAAAGAAGGTGG - Intergenic
1130051804 15:80490108-80490130 AAGTGGTGAGAGAGAGAAGCTGG + Intronic
1132185332 15:99798331-99798353 AAGTGGGGCTGGAAAGGAAAGGG + Intergenic
1133766554 16:8842337-8842359 AGGAGGGGCTACAAAGAAGAAGG + Intronic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1138612033 16:58132810-58132832 CAGTGCTGCTATAATGAAGATGG + Intergenic
1139322813 16:66129155-66129177 AACTGGTGCTGGAAAACAGAAGG - Intergenic
1140899911 16:79358009-79358031 AAGTGGTGCTGGACACAAGTTGG - Intergenic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1142642005 17:1289645-1289667 AAGGGGTGCTGGGGAGAAGAAGG - Intronic
1143355260 17:6323135-6323157 AATTGGTTGTAGAAAGAAGAAGG - Intergenic
1144156438 17:12508631-12508653 ATCTGGGGCTGGAAAGAAGAGGG - Intergenic
1144159743 17:12546098-12546120 AGGTGGTGCTAGAGAGAGAATGG + Intergenic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1147367245 17:39967034-39967056 AAGTAGTGGTTGAAAGAAGGAGG + Intronic
1147367399 17:39968151-39968173 AAGTAGTGGTTGAAAGAAGGAGG + Intronic
1149344878 17:55724636-55724658 AAGTGGTACTAGAAAATAGAGGG - Intronic
1149636774 17:58177221-58177243 AAGAGGTGCTGGAAAGAAGGAGG + Intergenic
1151089365 17:71418536-71418558 AAGTGGTATTAGCAAGAAGGTGG - Intergenic
1151094804 17:71484654-71484676 AAGTGCTGCTAGTAAGCAGATGG + Intergenic
1153547971 18:6229008-6229030 AAGTGGTAGAAGAAAGAAAATGG + Intronic
1153638048 18:7129904-7129926 ATGTGGAGCGAGAATGAAGAAGG + Intergenic
1153748236 18:8202347-8202369 AAGTGGTGCTAGAAAGAAGAGGG + Intronic
1153942266 18:9988609-9988631 AAGTGTTGATAGAAGGATGAAGG - Intergenic
1154272665 18:12933333-12933355 ATGTGCTGCTAGAATGGAGAAGG - Intergenic
1155208208 18:23578701-23578723 AAGTGCTGCTGGAGAGAAGCTGG - Intronic
1155593548 18:27455220-27455242 ACCTGATGCCAGAAAGAAGATGG - Intergenic
1156017137 18:32559593-32559615 AAGGGTTGAAAGAAAGAAGAAGG + Intergenic
1156719020 18:40047174-40047196 AAGGGGTGAAAGAAAGAAGATGG + Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1158968542 18:62644671-62644693 AAGGGGAGCTGGAAAGAGGATGG - Intergenic
1159059701 18:63501685-63501707 AAGAGGTGCTGGAAAGGATATGG - Intronic
1159210825 18:65319020-65319042 AACTGTGGCTAGAAAGAAAAAGG + Intergenic
1159360580 18:67396407-67396429 AAGTGATGACAGAAAGATGAGGG - Intergenic
1162085177 19:8244508-8244530 AAGTGGAGCCAGAAAAGAGAAGG - Intronic
1163900010 19:20092865-20092887 AGGAGGGGCTACAAAGAAGAAGG + Intronic
1164003889 19:21132030-21132052 AAGAGGAGCTGCAAAGAAGAAGG + Intergenic
1165205626 19:34182929-34182951 AGATGGAGCTAGAAAGAGGAGGG - Intronic
1166431460 19:42731414-42731436 AAGTGGTGAGAGAAAAAAAAAGG - Intronic
1166434579 19:42756621-42756643 AAGTGGTGAGAGAAAAAAAAAGG - Intronic
1166491011 19:43260493-43260515 AAGTGGTGAGAGAAAAAAAAAGG - Intronic
1167622875 19:50568670-50568692 AGGGGGTGGAAGAAAGAAGAGGG + Intergenic
924962981 2:50688-50710 AAGTGATTCTAGAAAGGAAATGG - Intergenic
926068926 2:9868676-9868698 AAGTGGATCCAGAAAGAAGGAGG + Intronic
926528518 2:14012128-14012150 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
928350890 2:30553383-30553405 ATGAGGTTTTAGAAAGAAGATGG + Intronic
930647320 2:53925219-53925241 AAGTGGAGCTGGATATAAGACGG + Intronic
931084604 2:58815377-58815399 AAATGGTTCTAGAGAGAAGTGGG + Intergenic
931853787 2:66280601-66280623 AAGTGATGGTAAAAGGAAGATGG - Intergenic
932367044 2:71160183-71160205 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
932906412 2:75757467-75757489 TAGGGGTCCTAGAAAGAGGAGGG + Intergenic
933158017 2:78995191-78995213 AAGTGGGGAGAGAATGAAGATGG - Intergenic
933769878 2:85736702-85736724 AAGTGGTCCAAGAAAGAGCAGGG - Intergenic
934659091 2:96133661-96133683 TAGTGGTGCCAGGAAGAAGCTGG + Intronic
936638989 2:114291437-114291459 AAGTGGTGAGAAAAAAAAGAAGG - Intergenic
937261786 2:120591334-120591356 TGGTGGTGCTGGAAACAAGATGG - Intergenic
937792762 2:125979987-125980009 AAGAGGTGCTGGAAAGATTAGGG - Intergenic
938011971 2:127836013-127836035 AAATGGTACAAGAAAGAAAATGG + Intergenic
938809575 2:134840672-134840694 AGCTGGTGATAGAAAGGAGAGGG - Intronic
938844023 2:135189784-135189806 AAGTGCTGCAAGAAATAAAATGG + Intronic
939104872 2:137937452-137937474 ATGTGTTCCTATAAAGAAGAAGG + Intergenic
942174355 2:173317357-173317379 AAGTGGGACTGCAAAGAAGAAGG - Intergenic
942276580 2:174327788-174327810 AAGAGGTTCTAGGAAGGAGAGGG + Intergenic
942497085 2:176551149-176551171 AAGTGGTGTCCTAAAGAAGAGGG - Intergenic
943266378 2:185738326-185738348 AAAGGGCGCTAGAAAGGAGAAGG + Intergenic
943319303 2:186428055-186428077 AAGGGGTGGTAGAAAAAAGAAGG + Intergenic
943319458 2:186430394-186430416 AAGGGGTGGTAGAAAAAAGGAGG + Intergenic
945173652 2:207020712-207020734 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
945301291 2:208218481-208218503 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
946076374 2:217076986-217077008 AGGTTGAACTAGAAAGAAGATGG - Intergenic
946979056 2:225187150-225187172 AAAGGCTGCTAGAAAGCAGAAGG - Intergenic
947240233 2:227986610-227986632 AAGTGGTGGAAGAAAAATGAAGG - Intronic
947945299 2:234096600-234096622 AAAAGATGCTAGAAAGAGGAAGG - Intergenic
947955938 2:234191578-234191600 AAGTTGTTTTAGAAAGTAGAAGG + Intergenic
1168954420 20:1824851-1824873 AAATGTTTCTAGAAGGAAGAAGG + Intergenic
1170689200 20:18597328-18597350 AAGTGGAACTAGAAAGGAAAAGG - Intronic
1170729480 20:18960739-18960761 AATTGGTGCTTTTAAGAAGATGG + Intergenic
1172473299 20:35217294-35217316 AAGTTTTACTACAAAGAAGAAGG - Intergenic
1174045657 20:47730828-47730850 AAGGGCTGCTGGAAAGAATAAGG - Intronic
1174277858 20:49416813-49416835 AGGTGGTGGGAGAAAGAAGGTGG + Intronic
1174698246 20:52581721-52581743 AAGTGGTGACAGCAAGAAGTTGG + Intergenic
1174931395 20:54819237-54819259 AAGTGGTGGTAGAAAGTTGGTGG - Intergenic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1176458324 21:6932302-6932324 ATGTGTTCCTATAAAGAAGAAGG + Intergenic
1176836498 21:13797396-13797418 ATGTGTTCCTATAAAGAAGAAGG + Intergenic
1177100820 21:16895628-16895650 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1177609654 21:23430620-23430642 ATCTCGTGGTAGAAAGAAGAAGG - Intergenic
1178463112 21:32821032-32821054 AAGTGTTATCAGAAAGAAGAGGG - Intergenic
1178862320 21:36299695-36299717 AGGCGGTGCTAGAAGGAAGAGGG + Intergenic
1178872384 21:36387103-36387125 AAGTTGCTCTAGAAAGAAGGCGG + Intronic
1181394083 22:22605975-22605997 AAGCAATGCAAGAAAGAAGACGG + Intergenic
1182026715 22:27124802-27124824 AGCTGGTGCCAGAAAGAGGAAGG + Intergenic
1182727650 22:32460689-32460711 AAATGGCTTTAGAAAGAAGATGG - Intronic
1184887355 22:47354588-47354610 ATGTGATGCTAGAAAGTAGATGG + Intergenic
1185415959 22:50710381-50710403 AGGTGGTGAGAGAGAGAAGAGGG + Intergenic
949600100 3:5588889-5588911 GAGTGGTGCTGGAAAGGAAAGGG - Intergenic
950997469 3:17518511-17518533 AAGGGGAGCTGGAAAGGAGATGG - Intronic
951108946 3:18778257-18778279 AGGATGTGGTAGAAAGAAGAGGG + Intergenic
952895021 3:38072913-38072935 AGGAGGGGCTACAAAGAAGAAGG + Intronic
953278098 3:41524372-41524394 AAGAGGTGGGAGAAAGAAGGTGG - Intronic
953675700 3:45000273-45000295 AAGGGGTGCTATGAGGAAGAAGG - Intronic
953685415 3:45074417-45074439 AAGTGGTGGAAGTAGGAAGAAGG + Intergenic
955243778 3:57204825-57204847 GAATGGTGCTAGATACAAGAAGG + Intronic
955571363 3:60310338-60310360 AACTGGTGCTGAAAAGAATAAGG + Intronic
958265849 3:91436033-91436055 AAATGGTGTAAGAAAGGAGAGGG - Intergenic
958475814 3:94580243-94580265 AAGTGCAGATAGAAAGAAAAGGG - Intergenic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
959219021 3:103491347-103491369 AAGTGGTGAAAGAGAGTAGAGGG + Intergenic
959523759 3:107351561-107351583 ATGTGGTGCTGGAACAAAGATGG - Intergenic
961987325 3:131151096-131151118 AAAGAATGCTAGAAAGAAGAGGG - Intronic
962046535 3:131765889-131765911 AAATGGTGCAAGAAAGACAATGG + Intronic
963325058 3:143853010-143853032 AAGATGTGCAAGACAGAAGAGGG - Intergenic
964233352 3:154496304-154496326 AAGTGGTTCTTGAAAGGAGATGG + Intergenic
964704847 3:159607120-159607142 AAATGGCACTAGAAAGAAAATGG - Intronic
964984691 3:162724773-162724795 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
965639837 3:170820208-170820230 AGGAGGGGCTACAAAGAAGAAGG + Intronic
965946228 3:174245014-174245036 AATTGTTGCTAGAAATTAGAGGG + Intronic
967894491 3:194385101-194385123 AAGGGGTGATACAAGGAAGAGGG - Intergenic
970196838 4:13559561-13559583 AAGTGTGGCTAGAAACAGGAAGG + Intergenic
970364676 4:15346570-15346592 TAATGGTGCAAGAAAGAAAATGG - Intronic
971662898 4:29443002-29443024 ATGAGGTACTTGAAAGAAGAGGG + Intergenic
971912694 4:32814855-32814877 AAGTGGAGAAAGAAAAAAGAGGG + Intergenic
973125360 4:46576773-46576795 AAATGGTGCTATAAATAATAGGG + Intergenic
973127051 4:46599676-46599698 AAATGGTGCTGGAAAAAAAATGG + Intergenic
973169246 4:47118978-47119000 AAGTGTTACTAGAAAAATGAAGG - Intronic
973205858 4:47559552-47559574 AAGTTTAGCAAGAAAGAAGATGG + Intronic
975070906 4:70136439-70136461 AATTGGTGATAGAAAGGTGATGG - Intronic
976061918 4:81138317-81138339 ATGTGGTGCTAGGGAGAAAAGGG - Intronic
976241974 4:82967389-82967411 AAATTCTGCAAGAAAGAAGATGG + Intronic
976513315 4:85935250-85935272 AAGTGGTGCTGGGAATGAGAAGG + Intronic
977357847 4:95969323-95969345 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
977443987 4:97105079-97105101 AAGTACTGCCAGAAAGAAAATGG + Intergenic
977858525 4:101926688-101926710 AAGTGGTGCGTAAAAGGAGATGG + Intronic
979504204 4:121476960-121476982 AATTGGTAAGAGAAAGAAGAGGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
981067115 4:140497619-140497641 AAGAGGTGGTAGAAAGGAGAGGG - Intronic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981249539 4:142583337-142583359 AAGTGGGGCAGGAAAGAAAAGGG - Intronic
981535091 4:145791363-145791385 AAGTGATGCTATGTAGAAGATGG - Intronic
982083781 4:151814858-151814880 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
982153151 4:152485779-152485801 AACTGGTGCTATAAAAATGAGGG + Intronic
982869145 4:160553752-160553774 AAGGGGAGCTAGAAGGCAGATGG + Intergenic
983164903 4:164463350-164463372 AAATGGGGCTACAAAGAAAAAGG - Intergenic
983887682 4:172998772-172998794 AAGTGTAGCTAGAAATAAGAAGG - Intronic
984140443 4:175999013-175999035 AAGTGGTTCTAGGTAGAATAAGG - Intronic
984424839 4:179570213-179570235 AAATAATTCTAGAAAGAAGATGG - Intergenic
984500201 4:180549154-180549176 AAGGGGAGATAGAAAGAAGTTGG - Intergenic
984543811 4:181074437-181074459 AAGGGGAGCTGGAAAGGAGATGG - Intergenic
985891283 5:2717114-2717136 GAGTGGTGCGAGGAAGAACAAGG - Intergenic
986137231 5:4992095-4992117 ATGTGGGTCTTGAAAGAAGAGGG - Intergenic
987651402 5:20744887-20744909 AAATGTTGCTAGATAGAAGGAGG + Intergenic
988520551 5:31941459-31941481 AAGTGCTGCAGGAAAGAAGGTGG + Intronic
988744154 5:34116566-34116588 AAATGTTGCTAGATAGAAGGAGG - Intronic
989559177 5:42831486-42831508 TAGTGGAGCAAGAATGAAGAAGG - Intronic
989951616 5:50306064-50306086 AAGTGGTGAAAGAAAAAAAAAGG + Intergenic
992125133 5:73632123-73632145 CAGTGGTGCTGCAAACAAGAAGG - Intronic
992162973 5:74020460-74020482 CAGTGGTGACAGAAAGAAAATGG + Intergenic
992314132 5:75535361-75535383 AAAGGCAGCTAGAAAGAAGAGGG - Intronic
992940155 5:81752361-81752383 AAATGGGGTTAGAAAGAAGATGG + Intergenic
994052468 5:95378432-95378454 AAGTGGTGCCAAAAAGAAGGGGG + Intergenic
994472739 5:100229597-100229619 AAATGTGGCAAGAAAGAAGAAGG - Intergenic
994830424 5:104774897-104774919 AAGAGGAGCTGGAAAGAGGATGG + Intergenic
995523071 5:113029125-113029147 AAGTGGTGACAGAAAGAGGAAGG + Intronic
995970555 5:117965020-117965042 AACTAGTGCTAGAAAGGAGTTGG + Intergenic
996202715 5:120696626-120696648 AAGTGGTTCTCTAGAGAAGATGG + Intergenic
996363301 5:122674277-122674299 AATAGGTGCTATAAAAAAGAAGG + Intergenic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
996890672 5:128415649-128415671 AAGTGCTGCTATAAACATGAGGG + Intronic
997111061 5:131075239-131075261 AAGAGGTGATAGAAAGAATAAGG - Intergenic
997768483 5:136528908-136528930 AAGTTGTGCTAGATAAAACATGG - Intergenic
998009899 5:138686430-138686452 AATTGGTGCTAGGAAAATGAGGG - Intronic
999634079 5:153601902-153601924 CAGGGCTGCTAGAAAGGAGAAGG + Intronic
1000151331 5:158504113-158504135 AAATGGTGGTAGGGAGAAGAAGG - Intergenic
1000695661 5:164378614-164378636 TAGTGCTGCTATAAAAAAGAGGG + Intergenic
1000762994 5:165250002-165250024 AAGTGTTACAAGAAAGAAAAAGG + Intergenic
1003099938 6:3169328-3169350 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1003786026 6:9487902-9487924 AAGGGGTTGTGGAAAGAAGATGG + Intergenic
1003987100 6:11447792-11447814 AAGTGGTGGTAGCAGCAAGAAGG - Intergenic
1004056644 6:12145670-12145692 AAGTGATGCTAGCAGTAAGAGGG - Intronic
1005143928 6:22665714-22665736 AAGTGCTGAAACAAAGAAGATGG - Intergenic
1006381756 6:33702479-33702501 AGGTCCTGCTAGAAAGGAGATGG + Intronic
1007254706 6:40520664-40520686 CAGTGGTGCCAGCAAGGAGAGGG + Intronic
1007320040 6:41021522-41021544 AGATGGTGTTACAAAGAAGAAGG + Intergenic
1007325662 6:41057574-41057596 AAGTGGTCTGAGAAAGCAGAAGG + Intronic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1007498242 6:42276577-42276599 CAACGGTGCTAAAAAGAAGACGG - Intronic
1010954398 6:82073724-82073746 AGGTGGTGCTAGACAGGAGTAGG - Intergenic
1011072356 6:83399615-83399637 AAATGCTTCTAGAAAGAAAAAGG - Intronic
1012420205 6:99056543-99056565 GAGAGGTGCTATAAAGAAAATGG + Intergenic
1012569315 6:100702195-100702217 TAGTGGTGGCAGAAAGAGGAGGG + Intronic
1013247029 6:108296396-108296418 AACAGGTGCAAGAAAGAATATGG + Intronic
1014719728 6:124901621-124901643 AACTGATGCTAGAAAAAAAATGG + Intergenic
1014733927 6:125069019-125069041 AAGTGGTGTGGTAAAGAAGAAGG + Intronic
1014743303 6:125170752-125170774 AACAGGTGTTAGAAATAAGAAGG - Intronic
1015173751 6:130283299-130283321 AGGTGGTGTTTGAGAGAAGAGGG + Intronic
1015612959 6:135045505-135045527 CAGTGGTGCTGGAATGAAGCAGG + Intronic
1016021447 6:139240130-139240152 TAGTGTTTCTAGAAAGTAGATGG + Exonic
1017813414 6:158000400-158000422 ATGTGGTCCAAGAAAGATGAAGG - Intronic
1018106850 6:160496356-160496378 ATGAGGTGCCAGAAAGAAAAGGG - Intergenic
1018813696 6:167316245-167316267 CAGTGCTGCTAGGAAGAACAAGG - Intergenic
1019984663 7:4646874-4646896 ATGTGGTGCTAGATAGATGTTGG + Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1022825942 7:34013959-34013981 AAGTGGTGAGGGAAAGAAGATGG - Intronic
1026853001 7:73736538-73736560 AAGAGTTGCTGGCAAGAAGATGG - Exonic
1027237251 7:76305327-76305349 AAGTTGAGGTAGAAAGCAGATGG + Intergenic
1027744749 7:82059052-82059074 AAGGGAGACTAGAAAGAAGAAGG - Intronic
1028208088 7:88039906-88039928 AAGATGTGCTAAAAAGAAGCTGG - Intronic
1028292173 7:89078814-89078836 AAATGGTGGAAGAAAGAAGAAGG - Intronic
1028738355 7:94243743-94243765 ATCTGGTGCTAGGAAGATGAAGG - Intergenic
1029048840 7:97661669-97661691 AAGAGGTGGTAGAAAAATGAAGG + Intergenic
1029049630 7:97671001-97671023 AAATGAGGCTAGAAAGATGAAGG + Intergenic
1029702636 7:102257506-102257528 AAGTGGGGGTAAAAAGAAGGTGG + Exonic
1030645689 7:112058873-112058895 AAGTGAAGGCAGAAAGAAGAAGG + Intronic
1031412671 7:121458239-121458261 AAGTGGTGCTACAAAGAACTAGG - Intergenic
1031422273 7:121566236-121566258 AGGTGGGGCTACAAAGAAGAAGG + Intergenic
1032160415 7:129505257-129505279 AAGTGGTGCGGGGAAGGAGATGG + Intronic
1032183651 7:129704232-129704254 AAAGGGTGCTAGAACCAAGAAGG - Intronic
1033115912 7:138625066-138625088 AAGTTTTGCTACAAATAAGAAGG - Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033616405 7:143019880-143019902 AAGTGGTGAAAGAAAAAACAAGG + Intergenic
1035154698 7:156902878-156902900 AAGTGGTGATAGATTGAAAAAGG - Intergenic
1035386768 7:158478174-158478196 AGGTGCTGCTTGAATGAAGAAGG + Intronic
1035550525 8:520389-520411 AAGTGGTGCTGTAATGAACATGG + Intronic
1036149019 8:6280955-6280977 AGGTGATGGTAGTAAGAAGAGGG - Intergenic
1036155863 8:6341341-6341363 AAGAGGTGGTAGAAGGGAGAAGG - Intergenic
1037206154 8:16321791-16321813 ACATGGTGGTAGGAAGAAGAAGG - Intronic
1037415768 8:18648649-18648671 AAGTGCTGATAGCAAGAAAATGG + Intronic
1037528889 8:19755366-19755388 AAGTAGGGTTACAAAGAAGAAGG + Intronic
1038062898 8:23931801-23931823 AATTGCTCCTAAAAAGAAGAGGG - Intergenic
1039287468 8:36058038-36058060 AAGTGTTACTAGAAAGAAAAGGG + Intergenic
1039300348 8:36202353-36202375 AACTAGTGTTAGAAAGAATATGG - Intergenic
1040027142 8:42792236-42792258 GAGTGGTGCAGCAAAGAAGAAGG - Intronic
1040608716 8:48961332-48961354 AAGTGATTCCAGAAAGCAGAAGG + Intergenic
1041451083 8:58007442-58007464 AAGTGATGGTAAAAAGAAAATGG - Intronic
1043951111 8:86310112-86310134 CAGTGGTGCTAGAACAAAGCAGG + Intronic
1043951879 8:86318458-86318480 AAGTGGTGGTTGAAAAAAGAAGG + Intronic
1045723837 8:105147064-105147086 AAGTTGTGCTTGAAAAAAAAGGG + Intronic
1047116600 8:121849075-121849097 TACTGGTGCTAGATAAAAGAAGG + Intergenic
1047775515 8:128067309-128067331 ATGTGGGGCTAGAGAGTAGAAGG + Intergenic
1048339843 8:133529931-133529953 AACAGGTGCTAGAAAGGAGCGGG - Intronic
1048499609 8:134963785-134963807 AAGAGGCTCTAGAAACAAGAGGG - Intergenic
1049868629 8:144956510-144956532 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
1051515869 9:17929808-17929830 AACAAGTGCTAGAAAGAAAATGG - Intergenic
1052818574 9:33121265-33121287 AAGGTGTGCAAGACAGAAGAGGG + Intronic
1053022169 9:34702214-34702236 AATTGGTCCTAGAAAGATGAAGG + Intergenic
1055055812 9:72022792-72022814 AAGGGGTGCCAGAAAGAAACAGG + Intergenic
1055189658 9:73502348-73502370 AAGTGGGGAGAGAAAGAGGAAGG - Intergenic
1055323635 9:75106119-75106141 AGGTGGTGTTAGAGAGAGGAGGG + Intronic
1057068339 9:92075079-92075101 AAGAGGGGCTGCAAAGAAGAAGG - Intronic
1059957426 9:119532844-119532866 TAGGGGTGCTAGAAAGAAAATGG - Intergenic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1062692147 9:137847579-137847601 AGGAGGGGCTACAAAGAAGAAGG - Intronic
1185458634 X:323278-323300 CAGTGGTGTTAGAAATAATAGGG - Intergenic
1186081014 X:5931880-5931902 AAGTGGTAATAGAAAGATGCTGG + Intronic
1187192008 X:17044180-17044202 AAGAGGAGCTAGAAAGCAGATGG + Intronic
1188402106 X:29758341-29758363 AAGAGGTGAAAGAAAGGAGAGGG + Intronic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1188522513 X:31054468-31054490 AAGTGGTGGTAGATAGAATATGG + Intergenic
1188622028 X:32237461-32237483 AAGTGGTGCCAGAAAGATGGTGG - Intronic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1193955819 X:87860763-87860785 AAGTTGTACTATAATGAAGAGGG + Intergenic
1193985918 X:88239582-88239604 AAGTGTTCTCAGAAAGAAGAAGG - Intergenic
1194703702 X:97148372-97148394 AAATGGAGCTAGAAAGATTATGG - Intronic
1195336228 X:103857509-103857531 AAGTGGTGACAAGAAGAAGAAGG + Intergenic
1196695028 X:118602210-118602232 AAGGTGTGGTAGAAAGAACATGG - Intronic
1196885157 X:120237371-120237393 TAGTGCTGCTAGAAGCAAGAGGG + Intergenic
1197003008 X:121461266-121461288 AAGTAGTGCTACAAAAAACAAGG + Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1199535865 X:148902552-148902574 AAGTGGTGCTGGCAAGAAGTGGG - Intronic
1199572448 X:149280554-149280576 AAGTGGTGGGAGTAAGAAAAAGG - Intergenic
1199931321 X:152525954-152525976 TAATGGAGCCAGAAAGAAGAGGG - Intergenic
1200132466 X:153858374-153858396 AAGTGATTCCAGAAAGAAGCCGG + Intergenic
1200985270 Y:9296841-9296863 ATGGGGAGCTAGAAAGGAGATGG + Intergenic
1201937318 Y:19422433-19422455 AGGAGGGGCTACAAAGAAGAAGG - Intergenic
1202076344 Y:21041333-21041355 AGGAGGGGCTACAAAGAAGAAGG + Intergenic
1202367919 Y:24179524-24179546 AAGAGGGGCTAGAAAGGAAAGGG + Intergenic
1202502864 Y:25490593-25490615 AAGAGGGGCTAGAAAGGAAAGGG - Intergenic