ID: 1153751648

View in Genome Browser
Species Human (GRCh38)
Location 18:8238237-8238259
Sequence CACCTTTTGTAGTTGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 2, 2: 3, 3: 22, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153751647_1153751648 -6 Left 1153751647 18:8238220-8238242 CCATTACATGTAAGTTACACCTT 0: 1
1: 8
2: 24
3: 61
4: 292
Right 1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG 0: 1
1: 2
2: 3
3: 22
4: 96
1153751645_1153751648 7 Left 1153751645 18:8238207-8238229 CCTTCTTGTATTCCCATTACATG 0: 1
1: 6
2: 27
3: 89
4: 380
Right 1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG 0: 1
1: 2
2: 3
3: 22
4: 96
1153751643_1153751648 17 Left 1153751643 18:8238197-8238219 CCTTTCTCCTCCTTCTTGTATTC 0: 1
1: 1
2: 20
3: 129
4: 1031
Right 1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG 0: 1
1: 2
2: 3
3: 22
4: 96
1153751646_1153751648 -5 Left 1153751646 18:8238219-8238241 CCCATTACATGTAAGTTACACCT 0: 1
1: 6
2: 25
3: 96
4: 347
Right 1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG 0: 1
1: 2
2: 3
3: 22
4: 96
1153751644_1153751648 10 Left 1153751644 18:8238204-8238226 CCTCCTTCTTGTATTCCCATTAC 0: 1
1: 1
2: 5
3: 28
4: 252
Right 1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG 0: 1
1: 2
2: 3
3: 22
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153751648 Original CRISPR CACCTTTTGTAGTTGCCCCA TGG Intronic
906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG + Intronic
909892405 1:81024075-81024097 AATCTTTTATAGTTGCCTCAAGG + Intergenic
911042264 1:93600238-93600260 CACCATTTCCTGTTGCCCCAGGG + Intronic
911812707 1:102303787-102303809 TACCTTTTGTAGTTATCCTAAGG - Intergenic
917880396 1:179329995-179330017 CACCATTTGTAATTGCCCGTTGG + Intronic
922621591 1:226992825-226992847 CTCCTGTTGTAGTTGCCATAAGG - Exonic
923922646 1:238585813-238585835 CATCTTTTGGAGTTGTCCCCAGG + Intergenic
1062781426 10:213275-213297 CACCTTTTCTAGTTTGCACATGG + Intronic
1064684665 10:17847718-17847740 CATCTTCTGTGGCTGCCCCAGGG + Intronic
1066647474 10:37624533-37624555 CACATGTTGAAGTTGTCCCAAGG + Intergenic
1070270399 10:74948649-74948671 GAGCTTCTGCAGTTGCCCCAAGG - Intronic
1074394441 10:113085989-113086011 CACCTGCTGGAATTGCCCCAAGG - Intronic
1076395954 10:130137232-130137254 CTCCTTTTGTAGTCTTCCCAGGG - Intronic
1077997551 11:7466982-7467004 CACCTTCTGCAGGTGGCCCAAGG + Exonic
1078815648 11:14819709-14819731 CACCTTTTCTAGCTGCCCTCAGG - Intronic
1083277521 11:61605606-61605628 CACCTTCTGCACCTGCCCCAGGG + Intergenic
1087142744 11:94781437-94781459 CATCTTTTGGACTTTCCCCATGG + Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1091064649 11:132497807-132497829 TACCTTTGGTAGTTGCTTCAAGG - Intronic
1093152258 12:15636398-15636420 CACCTAATGTATTTCCCCCATGG - Intronic
1095581311 12:43803319-43803341 TCCCAATTGTAGTTGCCCCAGGG + Intronic
1098444914 12:70556518-70556540 CACCTTTTGTGGTTGTTCCATGG - Intronic
1102595140 12:113986534-113986556 CCCCTTTTGGGGTTGCCCCAAGG - Intergenic
1104441186 12:128794647-128794669 TACCTTTTCTAGTTTCCTCAGGG - Intronic
1106194829 13:27484089-27484111 CACCTTTTGGAGGTGGACCAAGG + Intergenic
1108077384 13:46695463-46695485 GAACTTTTGTAGGTGCCCCGAGG + Intronic
1111492999 13:89008942-89008964 CATCTTTTGAAAGTGCCCCATGG - Intergenic
1112013809 13:95314678-95314700 CCCCATTTCTAGTTGCCCTAAGG - Intergenic
1114544149 14:23486285-23486307 CTCCTTTTGTAGTCCCCCCGAGG + Intronic
1116469570 14:45271345-45271367 CACCTTTTTTAGTGGCTTCAAGG + Intergenic
1116528103 14:45932844-45932866 CACCTTTTGAAGTTTTCTCACGG - Intergenic
1116973664 14:51094115-51094137 CACCTTATGTAGTTTCCACATGG + Exonic
1118550325 14:66942762-66942784 CTTCTTTTCTAGATGCCCCAGGG + Intronic
1120089941 14:80320044-80320066 CACCTTCCGTAGTTACCCAAAGG - Intronic
1122869600 14:104631533-104631555 CAACTTTTGAAAATGCCCCATGG + Intergenic
1124101187 15:26695050-26695072 TACCTTTTATAATTGCCCCATGG - Intronic
1124168030 15:27346583-27346605 CACCTTTTGTAATTCTCCCATGG + Intronic
1128590632 15:68893645-68893667 CACCCTTTGTAGTTGTCCCACGG + Intronic
1129061090 15:72860955-72860977 TACCTTTTATAAATGCCCCAGGG + Intergenic
1129502983 15:76058495-76058517 CACCTCTTGGAATTGCCCCACGG - Intronic
1135942311 16:26832839-26832861 TATCTTTTGTAGTTGTCCCACGG - Intergenic
1137356191 16:47767431-47767453 TGCCTTTTGTTATTGCCCCATGG - Intergenic
1137921748 16:52495953-52495975 CACCTCTTTTTATTGCCCCATGG - Intronic
1138248241 16:55482920-55482942 CACCTTCTATGGCTGCCCCAAGG + Exonic
1141943916 16:87297094-87297116 GAGCTTTTGTAGCTGTCCCAGGG - Intronic
1146069350 17:29665810-29665832 GACCTTTTGTAATTAGCCCAAGG - Intronic
1149970538 17:61213874-61213896 GCCCTTTTGTATTTGTCCCAGGG + Intronic
1151593069 17:75059445-75059467 CACAGTTTGCAGCTGCCCCAAGG - Intronic
1152124680 17:78439147-78439169 CACCTCTTGTCCCTGCCCCAGGG + Exonic
1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG + Intronic
1156117971 18:33809948-33809970 CACTTTTTGTAATTGTCCCATGG - Intergenic
1157044412 18:44082022-44082044 CACCATTTTCAGTTGTCCCACGG - Intergenic
1157511707 18:48280063-48280085 CACATTTGGTTCTTGCCCCAAGG + Intronic
1163449227 19:17365802-17365824 CACCTTTTGCAGTTGCTCCTTGG + Exonic
1164533952 19:29070424-29070446 CACCTTTCTTAGCTGCCCCATGG - Intergenic
1167821882 19:51935875-51935897 CAGGATTTGTTGTTGCCCCAGGG + Intronic
1168461698 19:56564998-56565020 CACCTTCTGTAATTGTCCCATGG + Intergenic
926261762 2:11270492-11270514 CACCTTTTCTAGTGGTTCCATGG + Intronic
928600832 2:32901787-32901809 CACCTTTTGTGAATGCCCAAAGG - Intergenic
933629838 2:84643512-84643534 CTCCTTTTGTAGTTGTACCATGG + Intronic
938380246 2:130832342-130832364 CACCTTGTGTGTTGGCCCCAGGG - Intergenic
939773684 2:146357647-146357669 CGCTTTTTGTAGTCACCCCATGG - Intergenic
941266097 2:163365262-163365284 TATCTGTTGTAGTTGTCCCACGG + Intergenic
947182884 2:227427722-227427744 CACCTTTTGGGATGGCCCCAGGG - Intergenic
1169156844 20:3338615-3338637 TACCTTTTGAAATTGTCCCAGGG + Intronic
1175289493 20:57865759-57865781 TACCTTTTTTAATTGGCCCATGG + Intergenic
1177194439 21:17887939-17887961 TACCTATAGTAGTTGCCTCATGG + Intergenic
1180070483 21:45433619-45433641 CACCTTTTGAAGTCACCCCTGGG + Intronic
1183279637 22:36924935-36924957 CACCTTTGGGAGATGCCCCAGGG - Intronic
1183866326 22:40707109-40707131 GACCTTTTGTAATTGCCCAATGG + Intergenic
1185006681 22:48281522-48281544 CTCCTTTTGTAATTGTCTCACGG - Intergenic
951458531 3:22921839-22921861 TACATTTTGTAGTTTGCCCAGGG + Intergenic
954785079 3:53086815-53086837 CACCTTTGGGAGCTGACCCACGG - Intronic
958546628 3:95560798-95560820 AATCTTTTGTAGTAGCCTCAGGG - Intergenic
959958845 3:112273123-112273145 CAGGTTTTTTAGTTCCCCCAAGG + Intronic
960621509 3:119641368-119641390 CACTATTTGTAATTGCCCCAAGG + Intronic
963168299 3:142226784-142226806 TACCTTTTGTTGCTGCCCAAGGG + Intergenic
963235296 3:142949850-142949872 CACCTTTTGTAATTGCCCCACGG + Intronic
964756567 3:160094795-160094817 CACCTTTTGATGTTACCACATGG + Intergenic
965351447 3:167616561-167616583 CACATTTTCTAGCTGCCTCATGG - Intronic
965410655 3:168326490-168326512 CTCCTGCTGTATTTGCCCCAAGG + Intergenic
967151012 3:186650888-186650910 CACGTTTTCTAATTGACCCAAGG + Intronic
971273926 4:25177505-25177527 CACGTTTGGAAGTTGCCTCAAGG + Intronic
975121570 4:70734338-70734360 CCCCTTTTGTAATTGGCCCTTGG + Intronic
975706018 4:77112778-77112800 TACCTTTTGTAGGTGCTCCTGGG + Intergenic
976028013 4:80714720-80714742 CAACTTTTGTAGTTTCCAAAGGG - Intronic
978033532 4:103967391-103967413 CATCCTTTGTAGTTGTCTCATGG + Intergenic
981406065 4:144370960-144370982 CACCTGATTTAGTTGGCCCAGGG - Intergenic
984619638 4:181937660-181937682 CAGCTTTTGTAGTAGTGCCAGGG - Intergenic
988375579 5:30431095-30431117 CACCTTTTGAGATTGTCCCATGG + Intergenic
989506694 5:42234146-42234168 CACCTTTTGTAGGTGTCTCATGG + Intergenic
993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG + Intronic
996549268 5:124712671-124712693 CACCCTGTGGAGTTGGCCCAGGG + Intronic
998612023 5:143699735-143699757 CTTCTTTTGTACTTGCCCCTTGG - Intergenic
1004187061 6:13430075-13430097 CACCTTTTATAGCTGACCCTTGG - Intronic
1011660196 6:89588101-89588123 CAACTTTTCTAAGTGCCCCAAGG - Intronic
1011784774 6:90831377-90831399 GACCTTTTGCAGCTGCCCCATGG + Intergenic
1011885573 6:92090735-92090757 CTTCTTCTGTAGTTTCCCCAGGG + Intergenic
1012328595 6:97956342-97956364 CATGTTTTGTAGCTGCCCCATGG + Intergenic
1012501413 6:99892048-99892070 TACCTTTTGTAATTGTCCCAGGG + Intergenic
1021471484 7:21007598-21007620 TACCTTTTGTTGTGGCCTCAGGG - Intergenic
1023263464 7:38381104-38381126 TAACTTTTGTAGTTTCCCGAAGG + Intergenic
1023349733 7:39308711-39308733 CACCTTTTTTGGCTGCCCCCAGG - Intronic
1023637499 7:42227466-42227488 AACCTTTTGTAATTTCCCCGAGG + Intronic
1029808957 7:103026761-103026783 CTTCTTTTGTGGTTGCCCCATGG - Intronic
1031500238 7:122505687-122505709 CACCTTTTTCAGTTGTCTCATGG - Intronic
1031591362 7:123596121-123596143 CACTTTTTCTAGTTTCCCAAAGG + Intronic
1039171707 8:34754888-34754910 CATCTTTTTTAGCTGCCACATGG - Intergenic
1041082554 8:54227223-54227245 CACCTTTTGTGGGTGACCCCAGG - Intergenic
1042207216 8:66341571-66341593 CACGATTTGAAGTTACCCCAGGG + Intergenic
1043503150 8:80875703-80875725 CACCTTTTATTCTGGCCCCACGG - Intergenic
1044093873 8:88038006-88038028 CACCTTATGTTATTGACCCATGG + Exonic
1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG + Intergenic
1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG + Intronic
1050628790 9:7537000-7537022 CACCTTTTGTAAATGTCCTAAGG + Intergenic
1051798062 9:20898371-20898393 TAACTTTTGTAGTTGTCCCACGG + Intronic
1058800818 9:108543076-108543098 CACCTTTCATTCTTGCCCCAGGG + Intergenic
1188263145 X:28040796-28040818 CCCCTCTTGTGGCTGCCCCAGGG - Intergenic
1189681216 X:43518705-43518727 CACCTTTTGTGGTTACCTTAGGG + Intergenic
1191893630 X:65970658-65970680 CACCTTTTGTAGTTGAAGGAGGG - Intergenic
1193272803 X:79548523-79548545 CACATTTTGTATTAGCTCCAGGG - Intergenic
1195356829 X:104047282-104047304 GGCCTTTTGTAGTCACCCCATGG + Intergenic
1198059319 X:133028735-133028757 CACTTATTGTAGTTGCCCCATGG - Intronic
1199743684 X:150758392-150758414 CACCTTCTGTGGCTGCCCGATGG + Intronic