ID: 1153752317

View in Genome Browser
Species Human (GRCh38)
Location 18:8245344-8245366
Sequence TGGCCCAGTGGAGCATGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153752310_1153752317 19 Left 1153752310 18:8245302-8245324 CCCACTTCATCCTCCTCCATCAG 0: 1
1: 0
2: 1
3: 57
4: 578
Right 1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG 0: 1
1: 0
2: 2
3: 20
4: 296
1153752312_1153752317 9 Left 1153752312 18:8245312-8245334 CCTCCTCCATCAGTTTGTACTAC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG 0: 1
1: 0
2: 2
3: 20
4: 296
1153752314_1153752317 3 Left 1153752314 18:8245318-8245340 CCATCAGTTTGTACTACACACAC 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG 0: 1
1: 0
2: 2
3: 20
4: 296
1153752311_1153752317 18 Left 1153752311 18:8245303-8245325 CCACTTCATCCTCCTCCATCAGT 0: 1
1: 0
2: 9
3: 101
4: 1225
Right 1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG 0: 1
1: 0
2: 2
3: 20
4: 296
1153752313_1153752317 6 Left 1153752313 18:8245315-8245337 CCTCCATCAGTTTGTACTACACA 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG 0: 1
1: 0
2: 2
3: 20
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153752317 Original CRISPR TGGCCCAGTGGAGCATGCAC AGG Intronic
900083887 1:877601-877623 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900481344 1:2900924-2900946 GGGCCCAGAGCAGCAGGCACAGG - Intergenic
901079225 1:6574473-6574495 TGCCCCAGTGGAGCCTTCGCAGG + Intronic
901669320 1:10846196-10846218 TGGCCCAGGCCAGCATGCAGTGG + Intergenic
902561009 1:17277530-17277552 TGGATCAGTGGAGCATCTACGGG + Intronic
903354623 1:22738972-22738994 TGGCACAGTGAAGCATGCTCAGG + Intronic
904002393 1:27346143-27346165 AGGCCCAGTGGACCATGCCTAGG - Intronic
904937825 1:34144322-34144344 TGGTCCTCTGGAGCATGGACTGG - Intronic
906188468 1:43880032-43880054 TGTCCCAGGGGAGCATGAATTGG + Intronic
906557204 1:46723226-46723248 TGGAGCAGTGGAGCACACACTGG - Intergenic
909608657 1:77531699-77531721 TCACCCAGTGGATCCTGCACTGG + Intronic
909608660 1:77531703-77531725 TGGCCCAGTGCAGGATCCACTGG - Intronic
909759317 1:79269545-79269567 TCACCCAGTGGATCCTGCACCGG - Intergenic
910622587 1:89273300-89273322 TCACCCAGTGGATCTTGCACCGG + Intergenic
916326037 1:163561151-163561173 AGGCCCAGAGGAGCAAGCATAGG + Intergenic
917792050 1:178505332-178505354 TGGGCCAGTGGAGCAGACAGAGG + Intergenic
917931594 1:179826316-179826338 TGGCCCAGTGCAGCAAGGCCTGG - Intergenic
918071428 1:181135817-181135839 TGGCCCAGAGGAGCCATCACAGG - Intergenic
918511939 1:185321651-185321673 TCACCCAGTGGATCCTGCACAGG + Intergenic
919049706 1:192499012-192499034 TCACCCAGTGGATCCTGCACTGG + Intergenic
920525747 1:206664579-206664601 TGGCACAGTGGAGGAAGCATTGG + Intronic
920854796 1:209653492-209653514 TGGCCCTGGAGAGCCTGCACTGG + Intergenic
922464933 1:225840062-225840084 TGCCCCAGTGGAGCCGGCAGTGG - Intronic
922698301 1:227743003-227743025 GGGCCCAGTGGGCCATACACAGG - Intronic
923273819 1:232379896-232379918 TGGAACCGTGCAGCATGCACAGG + Intergenic
923573899 1:235140719-235140741 TCACCCAGTGGATCCTGCACCGG - Intronic
924243849 1:242062940-242062962 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1062763354 10:44334-44356 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1066227072 10:33393776-33393798 TGGGACACTGGAGCATGCACTGG - Intergenic
1066544166 10:36481933-36481955 TCACCCAGTGGATCCTGCACCGG + Intergenic
1066598275 10:37076388-37076410 TCACCCAGTGGATCCTGCACTGG - Intergenic
1067054164 10:43041618-43041640 TGCCTTAGTGGAGCATGCCCAGG - Intergenic
1067102404 10:43342832-43342854 GGGCCCAGCGCAGCAGGCACTGG - Intergenic
1067497431 10:46773473-46773495 CCGCCCAGTGGAGCCAGCACAGG + Intergenic
1067526997 10:47045093-47045115 TGGCCCACCTGAGCATGGACTGG + Intergenic
1067597221 10:47566942-47566964 CCGCCCAGTGGAGCCAGCACAGG - Intergenic
1070140570 10:73734552-73734574 CCGCCCAGTGGAGCCAGCACAGG - Intergenic
1070395959 10:76011426-76011448 TGGCCCCGTAGAGCATCCAGAGG - Intronic
1071085275 10:81862620-81862642 TCACCCAGTGGATCCTGCACTGG + Intergenic
1073532594 10:104245597-104245619 TCACCCAGTGGATCCTGCACAGG - Intronic
1074732542 10:116393777-116393799 TCACCCAGTGGATCTTGCACCGG - Intergenic
1077249703 11:1555559-1555581 CTGCCCAGTGGAGCCAGCACTGG + Exonic
1078819910 11:14868243-14868265 TGGCCCTATCGTGCATGCACAGG - Intronic
1078999098 11:16735578-16735600 TGGCACAGTGGAAAGTGCACTGG + Intronic
1080204504 11:29713079-29713101 TCACCCAGTGGATCCTGCACTGG - Intergenic
1080698037 11:34620125-34620147 TGACCCAGTGAAGCAGGTACAGG + Intergenic
1081115270 11:39192567-39192589 TCACCCAGTGGATCTTGCACTGG + Intergenic
1081126856 11:39333004-39333026 TCACCCAGTGGATCCTGCACCGG + Intergenic
1082698679 11:56401855-56401877 TCACCCAGTGGATCCTGCACCGG + Intergenic
1083006943 11:59355662-59355684 AGGCCCAGTGGAGCAGTCACAGG - Intergenic
1083546190 11:63550629-63550651 TCACCCAGTGGATCCTGCACCGG - Intergenic
1084210544 11:67619462-67619484 TCACCCAGTGGATCCTGCACCGG - Intergenic
1084562026 11:69910625-69910647 TGGCCCAGTGGAGCTTGTGGTGG + Intergenic
1085323337 11:75588266-75588288 TGGCCTAGTGGAGCCTGGGCCGG + Intronic
1086808100 11:91269181-91269203 TCACCCAGTGGATCCTGCACCGG - Intergenic
1093580095 12:20777346-20777368 TCACCCAGTGGATCTTGCACCGG + Intergenic
1093580954 12:20783715-20783737 TCACCCAGTGGATCTTGCACTGG + Intergenic
1094813229 12:34162093-34162115 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1095910575 12:47422483-47422505 TGGCCAAGTTGAGAATGCACAGG + Intergenic
1095959714 12:47826646-47826668 GGGCCCAGTGGAGCAAGTAATGG - Intronic
1096459965 12:51816725-51816747 TGCCCTGGTGGAGGATGCACAGG - Intergenic
1097213007 12:57386694-57386716 TCACCCAGTGGATCCTGCACTGG - Intronic
1098486312 12:71025887-71025909 TAGCCCAGGGGAGCACACACTGG + Intergenic
1099154531 12:79158035-79158057 TGGACCAGTGGGGAATGAACGGG + Intronic
1099228076 12:79993157-79993179 TCACCCAGTGGATCCTGCACAGG + Intergenic
1099450509 12:82801972-82801994 TCACCCAGTGGATCCTGCACGGG + Intronic
1103741391 12:123094014-123094036 TGGCCCAGTGCAGCAGGCCTGGG + Intronic
1104192639 12:126497621-126497643 TTGCCCAGTGTAGTCTGCACTGG - Intergenic
1104651103 12:130534642-130534664 TGGCACAGTGGTGCCTGCAGAGG + Intronic
1104822666 12:131687309-131687331 AAGTCCAGTGGAGCATGCCCTGG + Intergenic
1106357028 13:28992665-28992687 GGGCCCAGGGGAGCATGCGAGGG - Intronic
1106394756 13:29368912-29368934 TGGCCCCATGAAGGATGCACAGG - Intronic
1107265218 13:38545822-38545844 TGGGTCAGTGGAGCATGTGCCGG + Intergenic
1108435425 13:50397014-50397036 TCACCCAGTGGATCCTGCACTGG - Intronic
1109037649 13:57286523-57286545 TTGCCTAGTGGATCCTGCACGGG + Intergenic
1109515222 13:63435487-63435509 TGGGCCAGTGGAGGATGCAAGGG - Intergenic
1109563089 13:64077470-64077492 TCACCCAGTGGATCCTGCACCGG + Intergenic
1111441983 13:88292245-88292267 TCACCCAGTGGATCCTGCACTGG - Intergenic
1111747751 13:92291270-92291292 TCACCCAGTGGATCCTGCACAGG - Intronic
1113117121 13:106885405-106885427 GGGGACAGTGGAGCACGCACTGG - Intergenic
1113668307 13:112156478-112156500 TGGAGCAGTGGAGAATGCACTGG + Intergenic
1115980016 14:39040794-39040816 AGCCCCAGTGGATGATGCACAGG - Exonic
1116223113 14:42113428-42113450 TCACCCAGTGGATCCTGCACCGG + Intergenic
1118333403 14:64831736-64831758 TGCCCCAGTGGTGGACGCACAGG - Intronic
1118348590 14:64957761-64957783 TGGCCGAGTGAAGCATACCCTGG - Intronic
1119300243 14:73566268-73566290 TCACCCAGTGGATCGTGCACTGG + Intergenic
1122064827 14:99165591-99165613 TGGCACAGTGGAGCAAGTGCTGG + Intergenic
1122629624 14:103101632-103101654 TTGCCCAGAGGAGGATACACTGG + Intronic
1122815109 14:104308310-104308332 TGGCCCAGGACAGCATGCTCGGG - Intergenic
1123068586 14:105630195-105630217 TGGCCGAGTGGACCCTGCACAGG + Intergenic
1123072586 14:105648996-105649018 TGGCCGAGTGGACCCTGCACAGG + Intergenic
1123092609 14:105748522-105748544 TGGCCAAGTGGACCCTGCACAGG + Intergenic
1123098169 14:105776223-105776245 TGGCCGAGTGGACCCTGCACAGG + Intergenic
1123714707 15:23019257-23019279 TGGACGAGTGGATCGTGCACGGG - Exonic
1124036435 15:26057298-26057320 TCACCCAGTGGATCCTGCACTGG - Intergenic
1124634667 15:31357465-31357487 TGGCCCAGTAGACCACCCACAGG - Intronic
1124818397 15:33019421-33019443 TCACCCAGTGGATCCTGCACCGG + Intronic
1125517680 15:40331820-40331842 TGGCCGGGTGGAACAAGCACAGG - Intronic
1126179767 15:45773768-45773790 TGGCCCAATAGAGCATCCAATGG - Intergenic
1126599093 15:50410970-50410992 TGGCCCAGTCTAGAATGCAGTGG - Intergenic
1128061026 15:64736212-64736234 GACACCAGTGGAGCATGCACTGG + Intergenic
1128140978 15:65301005-65301027 GGCCCCAGTGGAGGATCCACTGG - Intergenic
1129179140 15:73860658-73860680 TGCCCCAGTGGTCCCTGCACAGG + Intergenic
1129373935 15:75115931-75115953 TCACCCAGTGGATCCTGCACCGG + Intronic
1129616654 15:77104254-77104276 TGGCCCAGTGGAGCAGCCAGGGG + Exonic
1129927970 15:79383060-79383082 ATGTCCCGTGGAGCATGCACAGG - Intronic
1129986970 15:79926500-79926522 TCACCCAGTGGATCCTGCACCGG - Intergenic
1130808494 15:87352427-87352449 AGGGCCAGTGGGGCAGGCACTGG + Intergenic
1131992308 15:98104200-98104222 TCACCCAGTGGATCCTGCACCGG + Intergenic
1132155989 15:99495544-99495566 AGGCCCAGGGGAGCATCCACAGG + Intergenic
1132600148 16:769553-769575 TCCCCCAGTGCAGCAGGCACAGG + Exonic
1132747072 16:1441260-1441282 TGGCCGTGTGGAGCAGGCAGGGG - Intronic
1134818196 16:17223531-17223553 TAGCACAGAGAAGCATGCACAGG - Intronic
1135004951 16:18812179-18812201 GGGCAGAGTGGAGCAAGCACGGG + Intronic
1135633807 16:24056932-24056954 TGGGCCCGTGGTGCATGCACAGG + Intronic
1137760123 16:50933904-50933926 TGGCCCAGTGGCGCATCCACAGG + Intergenic
1143904306 17:10197604-10197626 TGGACCAGGGGAGCAGGCAGTGG + Intronic
1145717549 17:27036480-27036502 TGGCCAGGTGGTGAATGCACAGG - Intergenic
1146577363 17:34006360-34006382 TGGCCCAGTGCAGGATGAAATGG + Intronic
1148016954 17:44528399-44528421 TCACCCAGTGGATCCTGCACCGG - Intergenic
1148694955 17:49553179-49553201 TATCCCCATGGAGCATGCACAGG - Intergenic
1148901433 17:50881265-50881287 AGGCACAGTGGGGTATGCACTGG + Intergenic
1151774465 17:76189985-76190007 TGGCCAAGTGTAGCAAGCAATGG + Intronic
1151788921 17:76291462-76291484 TGGCCCAGGTGAGCATGACCAGG - Exonic
1152261708 17:79270716-79270738 AGGCCCAGTGGAGGAGGAACAGG - Intronic
1152578245 17:81152788-81152810 AGGCAAAGTGAAGCATGCACTGG - Intronic
1152874588 17:82779483-82779505 TGTCCCTGTGGAGCATGCTTAGG - Intronic
1152956264 18:44665-44687 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1153389354 18:4536474-4536496 TAGCTCAGTTGAGCAGGCACTGG + Intergenic
1153526147 18:5996746-5996768 TGGACCAGTGGAGCATTGAAGGG + Intronic
1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG + Intronic
1154165125 18:12008978-12009000 TGGAGGAGTGGAGCCTGCACAGG + Intronic
1155219284 18:23669826-23669848 TGACCCAGTGGACAAGGCACAGG + Intergenic
1155271878 18:24149486-24149508 TCACCCAGTGGATCCTGCACTGG + Intronic
1157483893 18:48073550-48073572 TGGCCCAGAAGAGCAGCCACTGG - Intronic
1158685524 18:59610787-59610809 TGGCTCTGTGAAGAATGCACTGG - Intronic
1159744037 18:72209553-72209575 TCACCCAGTGGATCCTGCACCGG - Intergenic
1160825343 19:1077725-1077747 TGGCCCAGCTGGGCATGCAGAGG - Intronic
1161086408 19:2337633-2337655 TGGCCCAGCGGGGGACGCACAGG - Intronic
1162029400 19:7910899-7910921 TGGCCAGGTGGGGCGTGCACCGG + Intronic
1162107077 19:8376190-8376212 TCACCCAGTGGATCCTGCACCGG - Intronic
1162230224 19:9259939-9259961 TCACCCAGTGGATCCTGCACCGG - Intergenic
1162237827 19:9322022-9322044 TCACCCAGTGGATCTTGCACTGG - Intergenic
1162404330 19:10464454-10464476 TTGCCCAGGGTAGCATGCAGTGG + Intronic
1164570933 19:29373752-29373774 TGCCACAGGGGAGAATGCACGGG + Intergenic
925404915 2:3599738-3599760 TGGCCCAGGGAGGCAAGCACTGG + Intronic
926685764 2:15696709-15696731 GAGCCCAGTGGATCCTGCACTGG + Intronic
926873794 2:17452410-17452432 TGGGACAATTGAGCATGCACTGG - Intergenic
927148084 2:20179944-20179966 TGGCCCAGTGGGGCAGGGCCAGG + Intergenic
927942116 2:27111448-27111470 TCACCCAGTGGATCCTGCACCGG + Intronic
928106431 2:28473057-28473079 TCACCCAGTGGATCCTGCACTGG - Intronic
929253071 2:39780185-39780207 CGGCCCAGTAGAGCATGAGCTGG - Intergenic
930468152 2:51780270-51780292 TCACCCAGTGGATCCTGCACCGG + Intergenic
931893287 2:66699826-66699848 CAACCCAGTGGAGCATGCAGAGG - Intergenic
936050836 2:109222652-109222674 TGGCCCTGTGGAGCCTGGCCAGG + Intronic
936346968 2:111682276-111682298 TCACCCAGTGGATCCTGCACCGG - Intergenic
937450991 2:122001872-122001894 TGTCCCAGCTGAGCCTGCACTGG + Intergenic
937711769 2:124987345-124987367 TCACCCAGTGGATCCTGCACCGG + Intergenic
938126001 2:128672057-128672079 TCACCCAGTGGATCCTGCACCGG + Intergenic
938764334 2:134450351-134450373 CGGCCCAGTGGAGCCTCCGCTGG + Exonic
939509547 2:143089532-143089554 TCACCCAGTGGATCCTGCACTGG + Intergenic
942867365 2:180691813-180691835 TCACCCAGTGGATCCTGCACGGG - Intergenic
943106084 2:183546613-183546635 TCACCCAGTGGATCCTGCACTGG + Intergenic
943106088 2:183546617-183546639 TGCCCCAGTGCAGGATCCACTGG - Intergenic
943350601 2:186792556-186792578 TGGCCCAGTAGGCCATGCTCTGG - Intergenic
947079454 2:226379959-226379981 TAGTCCAGTGGAGCATTCCCTGG - Intergenic
947412067 2:229851142-229851164 TCACCCAGTGGATCCTGCACCGG - Intronic
947674003 2:231961392-231961414 TGGCCCAGTGGAGCAGAGCCTGG + Intronic
947842598 2:233217885-233217907 TGGGCTAGTGGGGGATGCACCGG + Intronic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
949009506 2:241670533-241670555 TGGTGCAGGGGACCATGCACAGG + Intronic
1170246547 20:14226932-14226954 TCGCCCAGTGGATCCTGCACTGG - Intronic
1173175834 20:40764033-40764055 TGGCCGAGCGGACCAGGCACAGG + Intergenic
1176205718 20:63887099-63887121 TGGCCTAGAGGAGCTTGCTCTGG - Intronic
1180086137 21:45508808-45508830 TGGCCCTGTGGAGCAGACAGTGG + Intronic
1180633421 22:17245542-17245564 TGGCCCAGTGGTTCATACATGGG - Intergenic
1180756303 22:18164313-18164335 AGGCCCAGTGCAGCGTGAACAGG - Intronic
1180786038 22:18548347-18548369 GGGCCAAGGGGAGCATGAACCGG - Intergenic
1181075467 22:20373121-20373143 AGGCCCAGTGCAGCGTGAACAGG + Intronic
1181131320 22:20734072-20734094 GGGCCAAGGGGAGCATGAACCGG - Exonic
1181242961 22:21487901-21487923 GGGCCAAGGGGAGCATGAACCGG - Intergenic
1181616959 22:24061449-24061471 TGCCCCAGGGGAGCATGGCCTGG - Intronic
1181634829 22:24169685-24169707 TGGGCCAGTGGAGGAGGCAGGGG - Intronic
1181802665 22:25357781-25357803 TGGTGCAGTGAAGCCTGCACAGG - Intronic
950068881 3:10136371-10136393 TCACCCAGTGGATCCTGCACCGG + Intergenic
951024775 3:17817607-17817629 TCACCCAGTGGATCCTGCACAGG + Intronic
951299435 3:20975684-20975706 GAGCCCAGTGGAGAATTCACAGG - Intergenic
953786838 3:45917374-45917396 AGGCCCAGAGGGGCATGCCCTGG - Intergenic
953983590 3:47425456-47425478 TGGCCCAGTGGAGCCTGCTAGGG + Intronic
954414522 3:50386617-50386639 TGGCACTGTGGATCCTGCACAGG + Intronic
955817438 3:62860486-62860508 TGGCCCTGTGGAACCTGCATAGG + Intronic
956195818 3:66651953-66651975 TCACCCAGTGGATCCTGCACCGG - Intergenic
958419950 3:93918010-93918032 TAACCCAGTGGATCCTGCACTGG - Intronic
958622264 3:96576394-96576416 GGGCCCAGTGGGGTAGGCACCGG + Intergenic
961635284 3:128329361-128329383 TGGCACAGAGGAGCATGCTCAGG - Intronic
961873436 3:130003814-130003836 CAGCCCAGTGGAGCATGTTCGGG + Intergenic
963589913 3:147245539-147245561 TCACCCAGTGGATCCTGCACCGG + Intergenic
964751938 3:160060954-160060976 TCACCCAGTGGACCCTGCACAGG - Intergenic
965220135 3:165918380-165918402 TCACCCAGTGGATCCTGCACCGG + Intergenic
966076137 3:175937798-175937820 TCACCCAGTGGATCGTGCACTGG - Intergenic
966190934 3:177271662-177271684 TCACCCAGTGGATCCTGCACCGG + Intergenic
966199007 3:177342266-177342288 TGGGCCAGTGGAATATGAACAGG + Intergenic
966245999 3:177808884-177808906 TCACCCAGTGGATCTTGCACCGG + Intergenic
966817674 3:183902564-183902586 TGGGCCAGTGGACCATGTAGTGG - Intergenic
967305887 3:188058990-188059012 GGGCCCAGTGAAGCCTACACAGG + Intergenic
967499073 3:190176983-190177005 TCACCCAGTGGATCCTGCACCGG + Intergenic
968181514 3:196598972-196598994 TCGCCCAGTGGATCCCGCACTGG + Intergenic
968358073 3:198123576-198123598 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
968477722 4:820297-820319 TGGCCCAATGGGGCAGGAACTGG + Intronic
968963604 4:3758221-3758243 TGGGTCAGTAGAGGATGCACTGG + Intergenic
969016732 4:4108303-4108325 CAGCCCAGTGGAGCATGTTCGGG + Intergenic
969737234 4:9000012-9000034 CAGCCCAGTGGAGCATGTTCGGG - Intergenic
970051317 4:11918060-11918082 TCACCCAGTGGATCCTGCACTGG - Intergenic
970182667 4:13415809-13415831 TCACCCAGTGGATCCTGCACTGG - Intronic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
973041727 4:45477285-45477307 TCACCCAGTGGATCCTGCACCGG + Intergenic
973854183 4:54993896-54993918 TCACCCAGTGGATCCTGCACCGG - Intergenic
976406459 4:84665125-84665147 TCACCCAGTGGATCCTGCACGGG - Intergenic
977885690 4:102250231-102250253 TCACCCAGTGGATCCTGCACCGG + Intergenic
978632911 4:110767562-110767584 TGGGACAAGGGAGCATGCACAGG - Intergenic
978917901 4:114148514-114148536 TCACCCAGTGGATCCTGCACTGG + Intergenic
980043299 4:127964171-127964193 TCGCCCAGTGGATCCCGCACCGG + Intronic
980877743 4:138678966-138678988 TGGCCCAGTGGAGACTATACTGG - Intergenic
982863470 4:160482194-160482216 TCACCCAGTGGATCCTGCACCGG - Intergenic
982868723 4:160550042-160550064 TCACCCAGTGGATCCTGCACCGG + Intergenic
983656821 4:170091657-170091679 TCCCCCAGTGGAGCCGGCACTGG - Intronic
984241763 4:177227499-177227521 TCACCCAGTGGATCCTGCACCGG + Intergenic
984770644 4:183433571-183433593 TCACCCAGTGGATCCTGCACCGG - Intergenic
985277357 4:188250869-188250891 TAACCCAGTCAAGCATGCACTGG + Intergenic
987299150 5:16581269-16581291 TGGGGCAGTGGAGCATGCACAGG - Intronic
987352221 5:17032409-17032431 TCACCCAGTGGATCCTGCACCGG + Intergenic
987383931 5:17311707-17311729 TCACCCAGTGGATCCTGCACCGG + Intergenic
988883674 5:35532054-35532076 TCACCCAGTGGATCCTGCACTGG - Intergenic
990344371 5:54856967-54856989 TGACCAAGTGGAGCCAGCACTGG - Intergenic
994230042 5:97301575-97301597 TCACCCAGTGGATCCTGCACTGG - Intergenic
994932365 5:106206023-106206045 TCACCCAGTGGATCCTGCACTGG + Intergenic
995656584 5:114433107-114433129 TCACCCAGTGGATCCTGCACAGG - Intronic
997616174 5:135247639-135247661 TGGCCCAGAGGAGCAGGCCAAGG + Intronic
997877510 5:137562749-137562771 TGGCCCAGGCTAGCATGCAATGG + Intronic
998489124 5:142530543-142530565 TGTCCCAGTTGAGCCTGAACTGG - Intergenic
999070136 5:148735928-148735950 TGAGACAGTGGAGCATGCATGGG - Intergenic
999515746 5:152299954-152299976 TGGCCCACTGCAGCATGCAGAGG - Intergenic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1001836469 5:174836815-174836837 TGCCCCAGTGGAGACTGCATGGG - Intergenic
1002264818 5:178022318-178022340 TGGCCGACTGCATCATGCACTGG - Intronic
1002294602 5:178223388-178223410 TGGCCATGTGGAGGATGGACTGG - Intronic
1003962778 6:11224465-11224487 TGCCCCAGGGGAGCATGCAAGGG + Intronic
1004501969 6:16217255-16217277 TCGCCCAGTGGGTCCTGCACTGG - Intergenic
1004647987 6:17581046-17581068 TCACCCAGTGGATCCTGCACCGG - Intergenic
1004912700 6:20301679-20301701 TCACCCAGTGGATCCTGCACTGG - Intergenic
1005436077 6:25813521-25813543 TGGCACAGCTGAGCCTGCACAGG + Intronic
1006296748 6:33173234-33173256 TGGCAGAGTGGAGCCTGCCCTGG - Intronic
1006748819 6:36364165-36364187 TCACCCAGTGGATCCTGCACTGG + Intronic
1007426335 6:41748587-41748609 TGGGCCAGGTGAGCAGGCACTGG - Intronic
1009471483 6:64031549-64031571 TCACCCAGTGGATCTTGCACCGG - Intronic
1013410706 6:109881079-109881101 TCACCCAGTGGATCCTGCACCGG + Intergenic
1014788553 6:125644880-125644902 TCACCCAGTGGATCCTGCACCGG - Intergenic
1015935255 6:138402410-138402432 TGGCCGATTGGAGAATCCACAGG + Intergenic
1016067290 6:139697857-139697879 TCACCCAGTGGATCCTGCACCGG + Intergenic
1016217282 6:141618641-141618663 TCACCCAGTGGATCCTGCACCGG - Intergenic
1018076572 6:160221483-160221505 TAGCCAAGTCGAGAATGCACAGG - Intronic
1019047531 6:169160348-169160370 TGGCCCAGAGGAGCAGGAATTGG + Intergenic
1019176613 6:170162463-170162485 TTGTCCAGTGGAGCAGCCACCGG + Intergenic
1019329377 7:455158-455180 TGGGCCAGTGGAGAAGGCCCTGG - Intergenic
1019715973 7:2539548-2539570 TGACCCAGCTGAGCAGGCACTGG - Exonic
1019809329 7:3152979-3153001 TGGGGTAGTGGAGCATGCAGGGG - Intronic
1020008350 7:4793915-4793937 TCACCCAGTGGATCCTGCACAGG - Intronic
1020013492 7:4818480-4818502 TGACCCTGTGGGGCAGGCACTGG - Intronic
1020100571 7:5392049-5392071 CGGCCCAGTGGACCAGGGACAGG - Intronic
1022750518 7:33219400-33219422 TCACCCAGTGGACCCTGCACTGG - Intronic
1023760637 7:43462321-43462343 TGTCGGAGTGGAGAATGCACTGG - Intronic
1024443911 7:49454061-49454083 TCACCCAGTGGATCCTGCACTGG - Intergenic
1025961999 7:66231294-66231316 TCGCCCAGTGGATCCCGCACCGG + Intronic
1026512421 7:71038022-71038044 TCACCCAGTGGATCCTGCACCGG - Intergenic
1026736313 7:72950915-72950937 GAGCCCAGTGGAGGAGGCACGGG + Exonic
1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG + Intronic
1026992013 7:74591789-74591811 TGGCCCAGTGCAGCCTCAACAGG + Intronic
1027107420 7:75414147-75414169 GAGCCCAGTGGAGGAGGCACGGG - Intergenic
1027579635 7:79977537-79977559 TCACCCAGTGGATCCTGCACTGG + Intergenic
1030078877 7:105760212-105760234 TGACCCAGTGTGTCATGCACTGG + Intronic
1030366948 7:108657187-108657209 AGCCCCAGTGCAGCATCCACTGG - Intergenic
1031704060 7:124960213-124960235 TGGCTTATTGGAGAATGCACTGG - Intergenic
1034651850 7:152697548-152697570 TCACCCAGTGGATCCTGCACTGG - Intergenic
1036915055 8:12796690-12796712 TCACCCAGTGGATCCTGCACCGG - Intergenic
1037839344 8:22232664-22232686 TGGCACAGTGCAGGGTGCACAGG + Intergenic
1038638354 8:29304681-29304703 TCACCCAGTGGATCCTGCACAGG - Intergenic
1040351350 8:46571952-46571974 TCACCCAGTGGATCCTGCACTGG - Intergenic
1041318820 8:56592877-56592899 TGGCTCATAGGAGCATTCACAGG + Intergenic
1041719599 8:60964211-60964233 TTGCCCAATGGAGCCTGCTCAGG + Intergenic
1041732687 8:61078078-61078100 TGACCCAGGGAAGCCTGCACTGG - Intronic
1043110176 8:76169998-76170020 TCACCCAGTGGATCATGCACTGG - Intergenic
1043701197 8:83290777-83290799 TCACCCAGTGGATCCTGCACCGG - Intergenic
1044075900 8:87821261-87821283 TCACCCAGTGGATCCTGCACCGG - Intergenic
1044408009 8:91852390-91852412 TGGCCCACTGGGGCATGGCCAGG - Intergenic
1048112928 8:131487454-131487476 TCACCCAGTGGATCAGGCACCGG - Intergenic
1048512348 8:135074326-135074348 TGGTCCAGTGTAGCAACCACTGG - Intergenic
1048656519 8:136543807-136543829 TGGCACAGTGGAGAGTGCCCTGG - Intergenic
1049233307 8:141495303-141495325 TGGGCCACTGGGGCAGGCACAGG - Intergenic
1051303824 9:15685593-15685615 TGCCCCAGGCTAGCATGCACTGG - Intronic
1055985449 9:82054315-82054337 TCACCCAGTGGATCCTGCACCGG + Intergenic
1057300778 9:93880335-93880357 TCACCCAGTGGATCCTGCACTGG - Intergenic
1057726987 9:97574600-97574622 TCACCCAGTGGATCCTGCACCGG - Intronic
1058174792 9:101724049-101724071 TCACCCAGTGGATCCTGCACCGG + Intronic
1059420397 9:114186952-114186974 TGGCCCAGTGCAGGGAGCACTGG - Intronic
1060593102 9:124831765-124831787 AGCCCCAGTGGAGCCTGCATGGG + Intergenic
1061416606 9:130450619-130450641 TGGGACCGTGCAGCATGCACGGG + Intronic
1061734660 9:132645766-132645788 TTGCCCAGTGGAGTGTGCAAGGG + Intronic
1061908917 9:133712654-133712676 TGGCCCACTGGATCATCCATGGG - Exonic
1062741940 9:138180111-138180133 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1190413891 X:50163266-50163288 TCACCCAGTGGATCCTGCACCGG + Intergenic
1192042804 X:67641034-67641056 TGGCCCTATGGACCAGGCACAGG - Intronic
1192607322 X:72532119-72532141 TTGCCCAGGCTAGCATGCACTGG + Intronic
1193708896 X:84856580-84856602 TCACCCAGTGGATCCTGCACCGG + Intergenic
1196050771 X:111301503-111301525 TGGCCCAGAGGAGAAATCACAGG + Exonic
1196101492 X:111851979-111852001 TGGCCCAGTGATGCTTGCATGGG - Intronic
1198300060 X:135325880-135325902 TCACCCAGTGGATCCTGCACCGG - Intronic
1199831723 X:151555126-151555148 TCACCCAGTGGATCCTGCACCGG + Intergenic
1200213984 X:154359392-154359414 TGGACCAGGGGAGCTGGCACGGG - Exonic