ID: 1153752355

View in Genome Browser
Species Human (GRCh38)
Location 18:8245682-8245704
Sequence TATCTGTGTGGTCCCCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153752355_1153752359 30 Left 1153752355 18:8245682-8245704 CCTTGAAGGGGACCACACAGATA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1153752359 18:8245735-8245757 GTTCCAAATCTTCTATTTCATGG 0: 1
1: 0
2: 0
3: 19
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153752355 Original CRISPR TATCTGTGTGGTCCCCTTCA AGG (reversed) Intronic
902392757 1:16115866-16115888 TATCTCTGTGGTCTCCCTCGTGG + Intergenic
919053578 1:192541288-192541310 TATCAGTGTGGTCCCCCTGTTGG - Intergenic
1063503548 10:6576246-6576268 TATCTGCGTGTTCCTCTTCACGG + Intronic
1064796648 10:19019584-19019606 TATCTGTGGGGTTCACCTCAAGG - Intergenic
1070558317 10:77546756-77546778 TATCTGTGTGCTCCCCTGACAGG - Intronic
1072764319 10:98083496-98083518 TATCTGCTGGGTCTCCTTCACGG - Intergenic
1074229628 10:111521045-111521067 TATCTGTAACGTCCCCTTGAAGG + Intergenic
1075822759 10:125328824-125328846 CATCTCTGTGGTCGCCTGCATGG + Intergenic
1077695663 11:4390337-4390359 TATCTGCCTGGACCCCTTCGTGG - Exonic
1077907579 11:6546112-6546134 TATCTGAATGGTGCCCTGCAGGG + Exonic
1080196017 11:29609835-29609857 TATCTGTGGTGTCACCTTCAGGG - Intergenic
1083635891 11:64120851-64120873 GATCAGAGTGGTGCCCTTCAGGG - Intronic
1084183830 11:67459996-67460018 TCTCTGTCTCGTCTCCTTCATGG - Exonic
1084898851 11:72294795-72294817 CATCTGTGTGGTCCTGGTCAAGG + Intronic
1086115597 11:83246132-83246154 TATCTGTGGGCTCCACATCATGG + Intronic
1087321291 11:96662355-96662377 TCTATGTGTTGTCCCATTCAAGG - Intergenic
1089458532 11:118639576-118639598 TATCCCTATGCTCCCCTTCAAGG - Intronic
1094042915 12:26135996-26136018 TATCTGTGGGCTCCCATCCATGG + Intronic
1095508025 12:42919181-42919203 AATTTGTGTGGTTTCCTTCAAGG - Intergenic
1097148411 12:56957804-56957826 TATATGTGTGTGCTCCTTCATGG - Exonic
1103548079 12:121715793-121715815 TAGCTGTGTGGCCCCCGTCCAGG - Intronic
1104417973 12:128611233-128611255 CATGTGTGTGCTCCCCTTAAAGG + Intronic
1106111380 13:26780567-26780589 TATCTGTGCGGTTCCCTCCTTGG + Intergenic
1106595168 13:31129472-31129494 TCTCTGCGTGTTCTCCTTCAAGG + Intergenic
1113768692 13:112895437-112895459 TGTCGGTGTGGTCCCCTCCCTGG + Intronic
1114327424 14:21603131-21603153 TTTCTCTGTGGTCCCCTTTGGGG - Intergenic
1115381538 14:32745733-32745755 TACCTGTGTGCTTCCCTTCAGGG + Intronic
1117673109 14:58127757-58127779 TCTCTGTGTGGTCCGCACCATGG + Intronic
1119886809 14:78150391-78150413 TTTCTGCCTGGTCCCCTTAATGG + Intergenic
1121931368 14:97975600-97975622 TATCTTTATTGTCCCCTCCATGG - Intronic
1127330397 15:57933162-57933184 TATGTGAGGGGCCCCCTTCACGG - Intergenic
1128633015 15:69284379-69284401 CATCTGTCCGGTCCTCTTCATGG + Intergenic
1131226305 15:90627115-90627137 AATGAGAGTGGTCCCCTTCAGGG + Intronic
1131301950 15:91207468-91207490 GGTCTGTGTGGTCCCCACCAAGG + Intronic
1135194428 16:20382968-20382990 CATCTGTGTTTTCCCCATCAAGG - Intronic
1136571475 16:31100023-31100045 TATCTATGTTGTCCTCTGCATGG + Intergenic
1138035276 16:53598664-53598686 AATCTGTTTGTTCCCATTCATGG + Intronic
1138440366 16:57030718-57030740 TAGCTGTGTGTTGCCCTCCATGG + Intronic
1143729588 17:8873450-8873472 CATCTGTGTGATCCTTTTCATGG + Intergenic
1148935282 17:51160164-51160186 TATCTATTTGGTCTCATTCATGG - Intronic
1149157283 17:53647318-53647340 GATCTGTGTCTTTCCCTTCAGGG + Intergenic
1151262267 17:72925527-72925549 TATCTGTGTGTTCCTCACCACGG + Intronic
1152451327 17:80382625-80382647 CATCTGTGTGGTCTGCCTCAGGG + Intronic
1153752355 18:8245682-8245704 TATCTGTGTGGTCCCCTTCAAGG - Intronic
1154205291 18:12330954-12330976 TATTTGTGTGGTCCAATGCATGG - Intronic
1154966832 18:21366879-21366901 TATCTGCGTGGTCACCATGAAGG - Intronic
1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG + Intronic
1156771655 18:40734972-40734994 TATGTATGTGTTCCCCTTGAAGG - Intergenic
1157726745 18:49970227-49970249 GATCTGTGAAGTCGCCTTCAGGG - Intronic
1161621207 19:5298344-5298366 TATCTGAGGGTTCCCCATCAGGG - Intronic
1162251007 19:9443504-9443526 TATCCTTGTGGTCTCCTTAAGGG - Intergenic
930733281 2:54749262-54749284 TTTCTGTTTGGTCTCTTTCATGG + Intronic
932569907 2:72933134-72933156 ACACTGTGTGGTCTCCTTCAGGG - Intronic
933695308 2:85213094-85213116 CATCTTTGTGCTCCCCTTCAAGG - Intronic
936580311 2:113694554-113694576 TTTCTGTCTGGACCCCTTGATGG + Intergenic
938149378 2:128868863-128868885 AGTCTGTGTGGTGCCCTGCAAGG + Intergenic
939384324 2:141476125-141476147 TGTCTGCGTGCTCCCCTTCCTGG + Intronic
940433404 2:153621513-153621535 TACCTGTGTCCTTCCCTTCAGGG + Intergenic
1170526198 20:17240335-17240357 TATCTGTGTTGTCCCATCAAAGG + Intronic
1171048027 20:21829241-21829263 TATCTGTGTGGTAGCATTTAGGG - Intergenic
1172891371 20:38268218-38268240 GATCTGAGTGGTCCACTCCAAGG - Intronic
1173036563 20:39417250-39417272 TTTCAGTGTGGTTCCCTTCAAGG - Intergenic
1177426298 21:20927096-20927118 TTTCTGTGAGGTCCTCTTTATGG + Intergenic
1178338135 21:31762295-31762317 TATCTGTATGGTTCCCATCTAGG + Intergenic
1178362235 21:31958234-31958256 TTTCTCTGTGGTCCCCTTCCGGG + Intronic
1182388806 22:29972325-29972347 TAACAGTGTGGTCCTCTTCCTGG + Intronic
1183003831 22:34883779-34883801 TATCTGTATCTTCCCCTCCAGGG + Intergenic
1183076641 22:35431545-35431567 TATCACTGTGGTCACCTCCAGGG - Intergenic
950108294 3:10402241-10402263 TATCTGTGTGGTCCTGGTCACGG - Exonic
951143914 3:19202890-19202912 TATGTGTGTAGTCCCCATAATGG - Intronic
953133718 3:40164838-40164860 TATCTGTGTGGATCCCTGGAAGG - Intronic
953136369 3:40185732-40185754 TATAAATGTGGTCCCCTACATGG - Intronic
953682225 3:45048289-45048311 GATCTGAGTGGTGCCCTCCATGG - Intergenic
954144955 3:48629954-48629976 TATCTGGCTGGTGACCTTCACGG - Exonic
959079450 3:101784568-101784590 TTTCTGTGTCCTGCCCTTCATGG + Intronic
959354969 3:105314592-105314614 TATCTGTGCCGGCCCATTCATGG + Intergenic
959798049 3:110456705-110456727 TATCTGTTTCCTTCCCTTCAGGG + Intergenic
960991370 3:123313794-123313816 AATCTCTGAGGTCCCCTCCAGGG + Intronic
961209676 3:125116144-125116166 CTCCTGTGTGGTCCCCTTTAGGG + Intronic
962631157 3:137277237-137277259 GATCTCTATGATCCCCTTCATGG + Intergenic
964059511 3:152504918-152504940 GATCTGTGTTTTTCCCTTCAGGG + Intergenic
969090448 4:4690119-4690141 TATCTGGGTGCTCTGCTTCACGG - Intergenic
972567329 4:40281589-40281611 TATCAGTGAAGTTCCCTTCAGGG - Intergenic
973696650 4:53496993-53497015 TCTCAGGGTGGTCCCCTGCAAGG + Intronic
973879807 4:55258415-55258437 TATCTTTGTTGTTTCCTTCAGGG - Intergenic
978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG + Intergenic
980483080 4:133414811-133414833 TCTGTATGTTGTCCCCTTCAAGG - Intergenic
982473000 4:155816437-155816459 TATCTGTGTTTTCCACTTGATGG + Intergenic
983302038 4:165938143-165938165 TGTTTGTTTGGTTCCCTTCAGGG + Intronic
985021978 4:185701409-185701431 TGTCTGTGTGGACATCTTCATGG + Intronic
985589819 5:758630-758652 TTTCTGGGTGGACGCCTTCAGGG - Intronic
986279912 5:6314449-6314471 TCTCTCAGGGGTCCCCTTCAGGG + Intergenic
986387314 5:7247414-7247436 TATCTGTTTGCTCCCCGTCCAGG - Intergenic
997395632 5:133557684-133557706 TCTCTGGGGGTTCCCCTTCATGG - Intronic
1000426802 5:161100751-161100773 TACCTGTGTGTTCACCCTCATGG - Intergenic
1005672891 6:28124892-28124914 CATCTGTCTGATCCCCTTCCAGG + Intronic
1007212259 6:40204676-40204698 TATCTGTCTGGTGATCTTCAAGG + Intergenic
1007519255 6:42438883-42438905 CACCTGTGTGATTCCCTTCAGGG - Intronic
1010560204 6:77340251-77340273 TGTTTGTGTTCTCCCCTTCAGGG + Intergenic
1012950315 6:105511493-105511515 GATCTGTGTAGACCCCATCAAGG + Intergenic
1015502723 6:133951206-133951228 TATTTGGCTGGTCCCCTTGAAGG + Intergenic
1020342164 7:7123839-7123861 TATCTGTGTAGTCAGCATCAGGG - Intergenic
1020806734 7:12799269-12799291 TATCTGTGTGCTGGCCTTCATGG + Intergenic
1021356643 7:19658866-19658888 TATCAGTTATGTCCCCTTCAAGG - Intergenic
1021446147 7:20735762-20735784 TCTCTGTGTTTTCCCCTACATGG - Intronic
1031189605 7:118530645-118530667 TATCTGTGTGTTTCCCTACTAGG + Intergenic
1031639037 7:124139834-124139856 GACCTGTGTCTTCCCCTTCAGGG + Intergenic
1033396269 7:140976718-140976740 TAGCTGTGTGGTACACTTCCTGG - Intergenic
1033446009 7:141422675-141422697 TCTCTGTGTGGTTCTCTTGAGGG + Intronic
1035240659 7:157527079-157527101 TTTCTCTGTGGTCACCTCCAAGG - Intergenic
1035665801 8:1378842-1378864 AGTCTGTGCCGTCCCCTTCAGGG + Intergenic
1036504894 8:9346398-9346420 CAGCTGTGTGGTACCCTGCAGGG - Intergenic
1038768950 8:30458246-30458268 TATCTGTGAGTTCCACATCATGG - Intronic
1039244574 8:35594922-35594944 TATTTGGGTAGTGCCCTTCATGG - Intronic
1046355805 8:113083146-113083168 CATTTCTGTGGTCCTCTTCAAGG - Intronic
1048434076 8:134399659-134399681 TATCTGTGCAGTCTCCTTCTAGG + Intergenic
1048563455 8:135567887-135567909 TTTCTATGTGCTACCCTTCAGGG - Intronic
1051905241 9:22087220-22087242 CAACTTTTTGGTCCCCTTCAAGG - Intergenic
1054957015 9:70923214-70923236 TAACTGTGTGTTCATCTTCATGG + Intronic
1057576343 9:96245596-96245618 TCTCTGTGTGGCGCCCTCCAGGG - Intronic
1057928546 9:99173388-99173410 AATCTGTGCAGCCCCCTTCATGG - Intergenic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1189975343 X:46456075-46456097 TATCTGTGTCGTGCCTTTTAAGG - Intronic
1190800316 X:53782378-53782400 TATCTGTGTGCTCCAGTTCTGGG + Intergenic
1193163694 X:78257849-78257871 TTTCTGTGTGGTGTCCTTCTGGG + Intergenic
1193984996 X:88229326-88229348 TGTCTGTGTCTTTCCCTTCAGGG - Intergenic
1196510149 X:116499690-116499712 TATCTGGGTCTTTCCCTTCAAGG + Intergenic
1197283640 X:124567800-124567822 TATCATTCTGTTCCCCTTCACGG + Intronic
1197812326 X:130456524-130456546 TTTCTGTGTGCTCCTCTGCAGGG + Intergenic
1199859114 X:151783842-151783864 TGTCTTTGTTGTCTCCTTCATGG + Intergenic
1199978218 X:152906625-152906647 GATCTGTGTGGACCCCTTTGGGG - Intergenic
1200560177 Y:4691370-4691392 GACCTGTGTCTTCCCCTTCAGGG - Intergenic