ID: 1153757375

View in Genome Browser
Species Human (GRCh38)
Location 18:8298042-8298064
Sequence TCCCCAGGACAAACCCAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153757369_1153757375 2 Left 1153757369 18:8298017-8298039 CCATGGAGATGAGATGGTGCCCC 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG 0: 1
1: 1
2: 3
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153757375 Original CRISPR TCCCCAGGACAAACCCAACC GGG Intronic
900374378 1:2346833-2346855 TCCCCAGGGCAGACCCCAGCAGG - Intronic
901866483 1:12110050-12110072 CCCCCAGGCCAAGCCCACCCCGG + Exonic
904333327 1:29780495-29780517 ATCCCAGGATAAACCCAACTTGG - Intergenic
904499912 1:30907979-30908001 ACCCCAAGACACACCCAGCCGGG + Intronic
908908377 1:69042738-69042760 TCCCCAGGATAAATCCCACTTGG - Intergenic
915337435 1:155153611-155153633 TCCCCGGGATAAATCCCACCTGG - Intergenic
917582264 1:176391221-176391243 TCCCCATGAAAACCCCATCCAGG - Intergenic
918145501 1:181752508-181752530 GCCCCAGGACAAAGCCACACAGG - Intronic
919468055 1:197945998-197946020 TCTCCAGGACAAACCACACAGGG + Intergenic
920394252 1:205632085-205632107 TCCCCCGGCCACACCAAACCCGG - Intergenic
921417981 1:214912566-214912588 GCCCTAGGACAAACCCATCATGG - Intergenic
922674387 1:227541955-227541977 TCCCCAGGCCGCGCCCAACCCGG - Intergenic
923688003 1:236167352-236167374 TCCCCAGGACTTACTCAACGTGG + Intronic
924442463 1:244097642-244097664 TCCCCAGGACAAACCCTACCTGG - Intergenic
1062760252 10:12074-12096 TCCCCAGGCCGCACCCACCCTGG + Intergenic
1067013890 10:42740984-42741006 TCCTCAGCACAAGCCCATCCAGG - Intergenic
1067036888 10:42927504-42927526 TCCCCAAGAGACACCCATCCTGG - Intergenic
1067565744 10:47335611-47335633 TCCCCAGGCCAAACTGGACCGGG + Intergenic
1070406107 10:76097752-76097774 TTCCCAGGATAAACCCTACTTGG + Intronic
1072338851 10:94426512-94426534 TTCCCAGGATAAACCCCACTTGG + Intronic
1072555536 10:96511809-96511831 TCCCCAGGTCACACCCAGCAGGG + Intronic
1073476064 10:103754664-103754686 TCCCCATCACTAGCCCAACCAGG - Intronic
1073631613 10:105155317-105155339 TCCCCAGGAAAAACTGAACCGGG + Intronic
1075023286 10:118966720-118966742 TCCACTGGACGAGCCCAACCAGG - Intergenic
1077047926 11:554475-554497 TCCCCAGGCCAAACCCAGTTGGG - Exonic
1078291892 11:10020029-10020051 TCCCCTGCCCAACCCCAACCAGG + Intronic
1080783487 11:35453131-35453153 TTCTCAGAACAAGCCCAACCAGG - Intronic
1081671382 11:44944519-44944541 TCCCCAAGACTAAACCAGCCAGG + Intronic
1082988405 11:59186866-59186888 TCCCCAGGATAAATCAAACCAGG - Intronic
1083920559 11:65779868-65779890 CCCCCAGGCCAGCCCCAACCCGG + Exonic
1084113780 11:67030184-67030206 TGCCCAGGGCAAACCCCTCCTGG + Intronic
1089297198 11:117476887-117476909 GCCCCAGGCCACACCCATCCTGG - Intronic
1089700481 11:120241118-120241140 GCCCCAAGCCAAGCCCAACCTGG - Intronic
1090762951 11:129853305-129853327 TCCTCAGGACCAGCCCCACCTGG + Intronic
1093261439 12:16942072-16942094 TTCCCAGGACAAATTCAACCTGG + Intergenic
1097249864 12:57626575-57626597 TCACCAGGACAACCCCTACTGGG + Exonic
1100697289 12:97109212-97109234 ACTCAAGGAGAAACCCAACCAGG + Intergenic
1101471283 12:104999397-104999419 CCCCCAGGACGCACCCCACCTGG + Intronic
1101744921 12:107532223-107532245 GCCCCAGGACAGACCCAACCAGG + Intronic
1101812456 12:108119752-108119774 TCCCTGGGGCAAACCCAGCCTGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101829505 12:108246386-108246408 TCACAAGGACAAACACTACCCGG - Intronic
1103847458 12:123911365-123911387 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847470 12:123911395-123911417 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847485 12:123911425-123911447 CCCCCAGGACAGACCCCCCCCGG - Intronic
1103847545 12:123911561-123911583 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847749 12:123912002-123912024 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847762 12:123912031-123912053 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847769 12:123912046-123912068 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847807 12:123912124-123912146 CCCCCAGGACAGACCCCCCCGGG - Intronic
1103847842 12:123912201-123912223 CACCCAGGACAGACCCACCCAGG - Intronic
1103847848 12:123912216-123912238 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847873 12:123912277-123912299 CCCCCAGGACAGACCCCCCCGGG - Intronic
1103847893 12:123912322-123912344 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847905 12:123912352-123912374 CCCCCAGGACAGACCCCCCCAGG - Intronic
1103847918 12:123912381-123912403 CCCCCAGGACAGACCCCCCCGGG - Intronic
1103847969 12:123912489-123912511 TGCCCAGGACAGACCCCCCCAGG - Intronic
1104400971 12:128475897-128475919 TCCCTTGGTCAATCCCAACCCGG - Intronic
1112309274 13:98303500-98303522 TCCCCAGAACATACACAACGAGG - Intronic
1114031588 14:18584478-18584500 TCCCCAGGCCACACCCACCCTGG + Intergenic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1115386293 14:32801707-32801729 TTCTCAGGACAAACAAAACCTGG - Intronic
1117211431 14:53504798-53504820 GCCTCAGGAGAAACCAAACCTGG - Intergenic
1118322330 14:64760403-64760425 CTCCCAGGAGAAACACAACCTGG + Intronic
1118808643 14:69258521-69258543 TCCTCAGCAAAAACCCAACTAGG + Intergenic
1118863033 14:69680278-69680300 ACTCCAGCACAAACACAACCAGG - Intronic
1119437926 14:74610461-74610483 TCCCCAGGACTAAACCCAACTGG + Intronic
1119600677 14:75974308-75974330 TCCCCAGGATGAACACATCCTGG + Intronic
1120525719 14:85574911-85574933 TACCCAGGACATACCAAACAAGG + Intronic
1122863062 14:104591247-104591269 CCCCAAGAACAGACCCAACCGGG + Intronic
1124998590 15:34748014-34748036 TGCCCAGGACAGACCCAATTTGG + Intergenic
1125601691 15:40918987-40919009 TCCACGGGACAAAGCCAGCCTGG + Intergenic
1128777375 15:70331912-70331934 TTCCCAGGACAAACCCCACTTGG + Intergenic
1129504598 15:76071002-76071024 TCCCCGGGACAAACCAGACTGGG - Intronic
1131119498 15:89813945-89813967 ACCCCAGGACATAGCCCACCTGG + Intronic
1132246877 15:100304117-100304139 TTCCCAGAACAAAGGCAACCAGG + Intronic
1132789104 16:1675227-1675249 TCCCCAGGACAGAGCTAACAAGG + Exonic
1133133201 16:3690921-3690943 GCCCCAGGCGAAACCCAGCCTGG - Exonic
1134558905 16:15190474-15190496 TTTCCAGGAAAAACCCAAGCAGG - Intergenic
1134919437 16:18102075-18102097 TTTCCAGGAAAAACCCAAGCAGG - Intergenic
1136102054 16:28003749-28003771 TCCCCACCCCCAACCCAACCAGG + Intronic
1137883072 16:52072844-52072866 TACCCAGGACAACCACTACCAGG - Intronic
1139924368 16:70478100-70478122 TCCCCAGAACAATCCCAGCAAGG - Intronic
1140421745 16:74824878-74824900 TCCACAGCACAAACCCTCCCAGG - Intergenic
1141017063 16:80460633-80460655 TTCCCAGGAGAAAGCAAACCTGG + Intergenic
1142175528 16:88643373-88643395 TCCCCAGGTCAACCCCATCCCGG - Exonic
1142198064 16:88747956-88747978 TCCCCTGGAAAAACGCAGCCCGG + Intronic
1142277266 16:89127052-89127074 TTCCCAGGACAAACCCCACTTGG + Intronic
1143786658 17:9260712-9260734 GCCTCAGCACAAACCCACCCAGG - Intronic
1144421283 17:15101430-15101452 TTCCCAGAACAAACACAACCTGG - Intergenic
1145039007 17:19562843-19562865 TGGCCAGGATCAACCCAACCTGG + Intronic
1147758397 17:42782552-42782574 ATCCAAGGACACACCCAACCTGG - Intronic
1151444133 17:74152277-74152299 TCCCCGGGAGAATACCAACCAGG + Intergenic
1151610447 17:75170358-75170380 TCAACAGGTCAAACCCATCCTGG + Intergenic
1152170273 17:78741769-78741791 TCTCCTGGTCAAACCCAACCAGG + Intronic
1152953160 18:12428-12450 TCCCCAGGCCGCACCCACCCTGG + Intergenic
1153648885 18:7221664-7221686 TCCCCAGGTCCATCCAAACCGGG - Intergenic
1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG + Intronic
1155894061 18:31301321-31301343 TCACCAGGACACACCCTAGCAGG - Intergenic
1160168361 18:76532297-76532319 TGCCCAGGACCCACCCACCCAGG - Intergenic
1160843646 19:1157257-1157279 TCCCCAGGATAAACCCTAGTGGG + Intronic
1161630020 19:5349236-5349258 TACCCAGCACAGACCCCACCTGG - Intergenic
1162322962 19:9980718-9980740 GCCCCAGAACAAACTCAACTGGG + Intronic
1162817682 19:13206375-13206397 TCCCCAAGAGAGACCCACCCAGG + Intergenic
1164646705 19:29863670-29863692 ACCCCAGCACACACCAAACCTGG + Intergenic
925175247 2:1778810-1778832 TCTCCTGGCCAAACCCAGCCAGG - Intergenic
925923656 2:8654961-8654983 GGCCCAGGCCTAACCCAACCTGG - Intergenic
926198742 2:10778687-10778709 TCCTCAGGACAGTCCCAGCCGGG - Intronic
926423009 2:12717179-12717201 TCTCCAAAACAAACCCCACCGGG + Exonic
926438207 2:12859074-12859096 GCCCCAGGAGAAACCAACCCTGG - Intergenic
927207301 2:20618583-20618605 GCCCCAGCACAGACCCAAACTGG - Exonic
927867964 2:26604611-26604633 TCCCCCAGACAAACAAAACCTGG + Intronic
932409387 2:71536248-71536270 TGCCCATGACACCCCCAACCAGG + Intronic
933324573 2:80818941-80818963 TCCCAAGGATAAAGCCAACTTGG - Intergenic
935522277 2:104122122-104122144 AACCCAGGACATACCCACCCAGG - Intergenic
936850801 2:116895656-116895678 TCCACAGGCCCAACCCAACATGG + Intergenic
937194901 2:120144818-120144840 TCCCCAAGATAAACCCTACTTGG - Intronic
937272497 2:120661946-120661968 TCCCAGGGCCAAACCCAACGGGG - Intergenic
937990867 2:127661606-127661628 TGCCCAGGGCACACCCAGCCTGG + Intronic
941138731 2:161749591-161749613 TCCCCAGGATAAATCCCACTTGG + Intronic
944324370 2:198386573-198386595 TCACCAGGAATGACCCAACCAGG - Intronic
945581645 2:211602480-211602502 ACCCCAGAACAACTCCAACCTGG + Intronic
1173330344 20:42071041-42071063 TCCCCATGTCATACCCAAGCTGG + Intergenic
1173654484 20:44690227-44690249 TCCCCAGGACAGGCCCCAGCTGG + Intergenic
1174169004 20:48604722-48604744 TCTCCAGGCCACACCCACCCAGG + Intergenic
1174394983 20:50241843-50241865 TCCCCACGACAAAGCCCACAGGG - Intergenic
1175321551 20:58091918-58091940 TCCTCAGAACATACCCAACCAGG + Intergenic
1175418170 20:58815508-58815530 TCCCCAGGACGGCCCCCACCAGG + Intergenic
1177024098 21:15900297-15900319 TCCCTTGGATAAATCCAACCTGG - Intergenic
1178844928 21:36166738-36166760 TCCCCAGGCCAAACACACCAGGG + Intronic
1179214155 21:39351492-39351514 TCCCCACCTCAACCCCAACCAGG - Intergenic
1180455700 22:15511535-15511557 TCCCCAGGCCACACCCACCCTGG + Intergenic
1181051089 22:20238649-20238671 TCCCCAGGAGCAGCCCAGCCTGG + Intergenic
1181104779 22:20567721-20567743 TCACCAGGGCAAACCCTGCCAGG - Intronic
1182735134 22:32527959-32527981 TCCCCAGGGCAAGCCCAGCTGGG - Exonic
1182777242 22:32840026-32840048 TCCCCAGGACAGACCTGCCCTGG + Intronic
1183093409 22:35538886-35538908 TGCCCAGCACAAACCCTCCCGGG + Intergenic
1184732058 22:46376285-46376307 TTCCTAAGATAAACCCAACCTGG + Intronic
951269004 3:20602746-20602768 TCCCCAGCACAAAGACAACAAGG + Intergenic
951712172 3:25594289-25594311 TCCCTGGGACAAAAGCAACCAGG + Intronic
955020127 3:55112110-55112132 TCCCTAGAACAAACCCAAGTTGG - Intergenic
961432176 3:126891099-126891121 TCCCCAGGACATACCCTAGCAGG + Intronic
962248654 3:133820934-133820956 TCCCCTGGACAGAGCCACCCTGG - Exonic
962609585 3:137063122-137063144 TTCCCAGGAAAGACCCAGCCGGG - Intergenic
963482355 3:145892242-145892264 TCCCCAGAACAAATCTAAGCTGG + Intergenic
965111629 3:164432222-164432244 TAACCAGGTCAGACCCAACCAGG - Intergenic
968085455 3:195872069-195872091 TCCCCTGGAGAACCCCCACCAGG + Intronic
968877519 4:3280805-3280827 TCCCCAGGGCAGACACTACCTGG + Intergenic
970814387 4:20136974-20136996 CCCACAGGACAAACTCAGCCAGG - Intergenic
971209261 4:24600229-24600251 TCCCCAGGACAAACCGTACCTGG - Intergenic
972362291 4:38338234-38338256 TTCCTAGGACAAACCCAACTTGG - Intergenic
973847158 4:54924568-54924590 TTCCCAGGACAAACCATACATGG - Intergenic
973953038 4:56036751-56036773 TCCCCAGTACCAAACCATCCTGG + Intergenic
974691624 4:65304651-65304673 GCCCCAGAATAAACCAAACCTGG + Intergenic
976196376 4:82535986-82536008 TCCCCACAACACTCCCAACCCGG - Intronic
976238273 4:82924414-82924436 TTCCCAGGATAAACCCTACTTGG + Intronic
977227848 4:94414607-94414629 TCCCCACGACTCACTCAACCCGG + Intergenic
977329709 4:95622064-95622086 GCCACAGGCCAAACCCAAACAGG + Intergenic
979111729 4:116765971-116765993 TCCCTGGGACAAATCCAACTTGG - Intergenic
982206565 4:153001279-153001301 TCCTCAGGAAAAACCAAAGCTGG + Intergenic
982339439 4:154280529-154280551 TCCCAGGGACAAACCCCACTTGG - Intronic
984202707 4:176745641-176745663 TTCTCAGGACAGACCCAAGCAGG - Intronic
985696840 5:1345505-1345527 TCCCCAGTACAAACCCATTGTGG + Intergenic
985972189 5:3387227-3387249 TCCACAGGAGAAAATCAACCAGG - Intergenic
989158032 5:38363254-38363276 TACCCAGGGCAAACACAACAGGG - Intronic
991176255 5:63690367-63690389 TCCCCAGGACAAACCATACCAGG + Intergenic
991693127 5:69245018-69245040 TCCCCAGGATAAATCCCACTTGG + Intronic
991977884 5:72200439-72200461 TTCCCAGTACAAAGCCAAACAGG - Intronic
992151728 5:73910505-73910527 CCTCCAGGACAAACCCACCCTGG - Intronic
992509162 5:77416411-77416433 GACCCAGGACAGCCCCAACCTGG - Intronic
995594142 5:113730699-113730721 TCCCCATGAAACACCCAACTGGG - Intergenic
996217727 5:120889798-120889820 TCCCCAGAACAAAACCTACTTGG + Intergenic
997248198 5:132369634-132369656 TCCCCAGGACAGGCCCCGCCCGG + Intergenic
1001382283 5:171312465-171312487 TCCCCAGGTCAAATCCACCTGGG + Intergenic
1002574356 5:180163604-180163626 TCCCCAGGATAAACCCCACTTGG + Intronic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1006030373 6:31173081-31173103 TCCCCAGGACAGAACCATCACGG + Intronic
1007297341 6:40835052-40835074 TCCCCAGGAGACACCCACCTAGG + Intergenic
1014616011 6:123600426-123600448 TCCCCTTTACACACCCAACCCGG - Intronic
1014687560 6:124522007-124522029 TCCTCAGTACTAACCCTACCGGG + Intronic
1015389526 6:132665388-132665410 GCCTCAGGAGAAACCAAACCTGG - Intergenic
1017901045 6:158718728-158718750 CCACCAGGACTAACCCAGCCTGG + Intronic
1020278411 7:6637804-6637826 CCCCCAGGACACACCCATCCAGG + Intronic
1023090060 7:36609071-36609093 GCCCAAGGTCAACCCCAACCCGG + Intronic
1030431110 7:109450382-109450404 TCCCTAGGATAAATCCCACCTGG + Intergenic
1031855692 7:126920205-126920227 CCCTCATGAAAAACCCAACCAGG + Intronic
1033607991 7:142941448-142941470 TCCACAGGACAAAGCTGACCCGG + Intronic
1036182063 8:6594187-6594209 TGCCCAGGTCATACCCAAACAGG + Intronic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1037738066 8:21582634-21582656 TGCCCAGGTCAAAGCCAACAGGG - Intergenic
1038216259 8:25564347-25564369 TTCCCACGACAAACCCAAGATGG - Intergenic
1040618635 8:49064559-49064581 CCCCCAGGACAAGCCCACCGAGG + Intronic
1048032552 8:130646331-130646353 TCTCCAGGACAAACTCAGCATGG - Intergenic
1048581528 8:135733049-135733071 TCCCCAGGACAAGCCTGACCTGG - Intergenic
1049332254 8:142060855-142060877 GCCCTGGGACCAACCCAACCCGG + Intergenic
1055842509 9:80522210-80522232 TTCCCAGGACAAACCCTATGTGG + Intergenic
1056207488 9:84334465-84334487 TCCCTGGGGTAAACCCAACCAGG - Intronic
1057303602 9:93900129-93900151 CCCCCAGGACAAAGTCACCCAGG + Intergenic
1059425446 9:114218125-114218147 TCCCCTGGACACAGCCCACCTGG + Intronic
1060423714 9:123487547-123487569 TCCACAGGACAATCGCATCCAGG - Intronic
1060484226 9:124037049-124037071 TCTCCAGGACATCCCCACCCGGG - Intergenic
1060666222 9:125433605-125433627 GCCCCAGGAGAAATCCAGCCAGG + Intergenic
1061272035 9:129549297-129549319 GCCCAAGGACACACCCAGCCAGG + Intergenic
1062301425 9:135874024-135874046 TCCCCAGGACAAACACAAATTGG - Intronic
1190627323 X:52349142-52349164 TTCTCAGGACAAACCCCACTTGG + Intergenic
1192309693 X:69999895-69999917 TTCCTAGGACAAACCCTACTTGG - Intronic
1192834574 X:74785705-74785727 GCCACTGAACAAACCCAACCAGG - Intronic
1192927738 X:75774320-75774342 TCCCTAGGATAAATCCAACATGG - Intergenic
1193013226 X:76701764-76701786 TCCCATGGATAAACCCAACTTGG - Intergenic
1194953666 X:100154853-100154875 ACCCTAGGATAAACCCAACTTGG + Intergenic
1195552796 X:106187155-106187177 TCCCCAGGGCAAACCCCAGATGG + Intronic
1196074541 X:111560981-111561003 TCCCCAGGGGAAACCTCACCTGG + Intergenic
1197211702 X:123833554-123833576 TCCCCTAGCCAAACCCTACCAGG + Intergenic