ID: 1153759404

View in Genome Browser
Species Human (GRCh38)
Location 18:8316206-8316228
Sequence CCAGTAGAGACTGCAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 335}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153759404_1153759411 6 Left 1153759404 18:8316206-8316228 CCAGCTCCTGCAGTCTCTACTGG 0: 1
1: 0
2: 0
3: 28
4: 335
Right 1153759411 18:8316235-8316257 GAGTACAGGGACAGTGTCCTAGG 0: 1
1: 0
2: 0
3: 17
4: 194
1153759404_1153759409 -7 Left 1153759404 18:8316206-8316228 CCAGCTCCTGCAGTCTCTACTGG 0: 1
1: 0
2: 0
3: 28
4: 335
Right 1153759409 18:8316222-8316244 CTACTGGGTCCTTGAGTACAGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1153759404_1153759413 29 Left 1153759404 18:8316206-8316228 CCAGCTCCTGCAGTCTCTACTGG 0: 1
1: 0
2: 0
3: 28
4: 335
Right 1153759413 18:8316258-8316280 CATCTTACTTCCCCTGCACCTGG 0: 1
1: 0
2: 1
3: 17
4: 166
1153759404_1153759408 -8 Left 1153759404 18:8316206-8316228 CCAGCTCCTGCAGTCTCTACTGG 0: 1
1: 0
2: 0
3: 28
4: 335
Right 1153759408 18:8316221-8316243 TCTACTGGGTCCTTGAGTACAGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153759404 Original CRISPR CCAGTAGAGACTGCAGGAGC TGG (reversed) Intronic
900409158 1:2505039-2505061 GCAGCAGAGACTGCAGGGCCTGG + Exonic
900924208 1:5692771-5692793 CCAGTGGTGGCTGCAGGAGGAGG + Intergenic
902633984 1:17723208-17723230 CCAGAAGAGCCTGTAGGATCAGG - Intergenic
904310589 1:29626939-29626961 ACGGTAGAAAGTGCAGGAGCAGG - Intergenic
904600228 1:31668870-31668892 TCATGAGAAACTGCAGGAGCCGG + Intronic
904826517 1:33276809-33276831 CCAGTGGACACGACAGGAGCCGG + Intronic
905354747 1:37373638-37373660 CCAGGAGAGCCTCCAGAAGCTGG + Intergenic
908256586 1:62308498-62308520 CCAGGAGAGAGATCAGGAGCAGG - Intronic
909235028 1:73141920-73141942 CCAGAAGATAATTCAGGAGCAGG + Intergenic
909477403 1:76096032-76096054 CAGGCAGAGATTGCAGGAGCTGG + Intronic
909907744 1:81220719-81220741 AGAGGCGAGACTGCAGGAGCAGG - Intergenic
911647763 1:100353501-100353523 CCAGCAGAGTAGGCAGGAGCTGG - Intronic
912414093 1:109496472-109496494 CAAGTAGAGGCTTCAGGATCAGG - Exonic
912530483 1:110317482-110317504 CTATTAGAGACTGGGGGAGCAGG - Intergenic
912794751 1:112686007-112686029 CCAGTAGGGAATGCAGGCCCCGG - Intronic
919639265 1:200033560-200033582 CCTGTAGAGGCCGCTGGAGCAGG - Intronic
920192310 1:204201547-204201569 CCAGCAGGGAGTGCAGAAGCTGG - Intronic
922337226 1:224627672-224627694 ACAGAGCAGACTGCAGGAGCGGG - Intronic
923794939 1:237144435-237144457 CCAGTAGAGACTGCGAGATAGGG + Intronic
1063176096 10:3552215-3552237 CCGGTTGAGACTGCTGGAGTGGG - Intergenic
1065080718 10:22127171-22127193 CCAGTAGTCATTTCAGGAGCAGG + Intergenic
1065918031 10:30368432-30368454 GCAGGAGAGGCTGCAGGAGCTGG - Intronic
1067508068 10:46873208-46873230 CCAGAAGAGCCTGCAGCATCTGG - Intergenic
1067557422 10:47282614-47282636 CCAGTTGACACAGCAGGAGGTGG + Intergenic
1067563856 10:47322695-47322717 CCAGCAGGGACAGCAGGGGCAGG - Exonic
1067654181 10:48178637-48178659 CCAGAAGAGCCTGCAGCATCTGG + Intronic
1069745979 10:70715373-70715395 CAAGCAGAGACTGTAGGAGCTGG - Intronic
1070946628 10:80397273-80397295 CCAGGAGAGGCTGGAGAAGCTGG + Intergenic
1072133419 10:92519439-92519461 CCAGCAGTGAATGGAGGAGCAGG + Intronic
1073541200 10:104317363-104317385 CCAGGAGATACTGCAGCTGCTGG - Intronic
1073561201 10:104498512-104498534 CCAGGAAGGACTGCAGGGGCAGG - Intergenic
1073945062 10:108740876-108740898 CCAGCAGAGGCTGCAGTAGCAGG - Intergenic
1075516499 10:123112868-123112890 CCAGCAGAGGCTGCAGAGGCTGG + Intergenic
1075631211 10:124001657-124001679 GCAGAAGAGATGGCAGGAGCAGG + Intergenic
1075719279 10:124575542-124575564 CCAGGAGAGGCTGCAGGACATGG - Intronic
1075988964 10:126816563-126816585 CCAGCAGGGAGTGGAGGAGCTGG + Intergenic
1076070433 10:127484286-127484308 CGAGAAGGGCCTGCAGGAGCCGG - Intergenic
1076173848 10:128348628-128348650 CCAGTAAAGACGGCTGGAGCTGG + Intergenic
1076230022 10:128812336-128812358 CCAGCAGAGAATGCAGAGGCTGG + Intergenic
1076509016 10:130999090-130999112 ACAGTAGCGAGTGCTGGAGCGGG - Intergenic
1076757188 10:132578747-132578769 CCAGGAGAGTGTGCAGGGGCTGG + Intronic
1077478557 11:2802477-2802499 CCCCTGGAGACTCCAGGAGCTGG + Intronic
1077519188 11:3021330-3021352 CCAGGAAAGGCTGCAGCAGCCGG - Intronic
1078798191 11:14615299-14615321 CAAGTAGAGAATGCTGGAGAGGG - Intronic
1079187005 11:18246885-18246907 CCAGCAGAGTCTGCAGAAACTGG - Intronic
1079189798 11:18268014-18268036 CCAGCAGAGTCTGCAGAAACTGG + Intronic
1079300569 11:19275560-19275582 CCAGCAGAAACTGCAAGGGCGGG - Intergenic
1079472429 11:20790701-20790723 CCCGTAGAGCAGGCAGGAGCAGG - Intronic
1079513228 11:21235500-21235522 CCTATAGAGACTGATGGAGCGGG + Intronic
1079875374 11:25849379-25849401 TCAGTAAAGACTGGAGGAGGAGG + Intergenic
1081912365 11:46707972-46707994 CAAGTGTAGACAGCAGGAGCAGG + Intergenic
1082801051 11:57415091-57415113 CCATTAGAGACCCCAGGGGCAGG - Exonic
1083196670 11:61092388-61092410 CCAGTAGAGGCTGAAGGTGGGGG - Intergenic
1083602243 11:63955975-63955997 CCAGGAGAGACTGCCAGAGTTGG - Exonic
1083652659 11:64212138-64212160 CCATTAGGGACTGCAGGACCTGG + Intronic
1084651987 11:70494892-70494914 ACAGGAGAGAATGCATGAGCAGG - Intronic
1084859540 11:72009291-72009313 CCAGTTGAGCCAGAAGGAGCAGG - Exonic
1085941406 11:81210190-81210212 TCAGTAGATCCTACAGGAGCTGG + Intergenic
1087487392 11:98772959-98772981 CATGTAGAGACAGCTGGAGCTGG + Intergenic
1092423893 12:8357550-8357572 CCAGTTGGGATTGCTGGAGCTGG - Intergenic
1095632829 12:44398312-44398334 GCAGCAGACACTGCTGGAGCTGG + Intergenic
1095948532 12:47767596-47767618 CCAATAGGGACAGCAGGAGTAGG + Intronic
1097853385 12:64436340-64436362 TCAGTTGAGACTCCAGGAGGTGG - Intronic
1098308731 12:69126859-69126881 CCAGAAGACACTGGAGAAGCAGG + Intergenic
1098792500 12:74842074-74842096 ACAGTAGAGACTGCAAAAGGTGG + Intergenic
1099102813 12:78463549-78463571 CTAGTAGAGATTGTAAGAGCAGG - Intergenic
1101706974 12:107229916-107229938 TCAGTATAGGCTCCAGGAGCTGG - Intergenic
1102172354 12:110852022-110852044 CAATTCCAGACTGCAGGAGCTGG - Intronic
1102193595 12:111008112-111008134 GCAGTGGAGAGTTCAGGAGCTGG + Intergenic
1103791747 12:123477016-123477038 CCAGGAGAGACTGAAGCAGAGGG + Intronic
1104350849 12:128042662-128042684 CCAGTAGGGTCTGCAGAAGAAGG - Intergenic
1104733343 12:131121148-131121170 CCAGTCGAGGCGGCAGGTGCAGG + Intronic
1104966146 12:132509582-132509604 CCAGGAGGGACCGCAGGCGCCGG - Intronic
1105499701 13:20961107-20961129 CCAGTCCAGACTGCAGGAGAGGG + Intergenic
1105923370 13:24985070-24985092 CCAGAAGATACAGCAGGAGAAGG + Intergenic
1106086667 13:26548800-26548822 CAAGTAGAGACAGCTGGAGAAGG - Intergenic
1110363137 13:74650560-74650582 ACAACAGAGACTGCAGCAGCTGG - Intergenic
1111850161 13:93563082-93563104 CCACTAGAGACTCCAGGAAATGG - Intronic
1112873945 13:104012128-104012150 CCAGTGGAGGGTGGAGGAGCTGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118280905 14:64427648-64427670 CCAACAGTGACAGCAGGAGCTGG - Intronic
1119109424 14:71957645-71957667 CCAGCAGAGATTGCAGTAACAGG + Intronic
1120405513 14:84090353-84090375 TCAGTAGCGACGGCAGGAGTAGG + Intergenic
1121554905 14:94829128-94829150 CCAGGTGAGGCTGCAGGGGCTGG - Intergenic
1122364308 14:101185423-101185445 CCAGCAGAGTCTGCAAGAGGAGG + Intergenic
1123133937 14:106010522-106010544 GCAGTAGAGCCTGCATGACCTGG + Intergenic
1123468661 15:20534240-20534262 CTAGGTGAGGCTGCAGGAGCTGG - Exonic
1123493164 15:20799154-20799176 ACAGTTAAGAATGCAGGAGCGGG + Intergenic
1123506302 15:20943030-20943052 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123549670 15:21368256-21368278 ACAGTTAAGAATGCAGGAGCGGG + Intergenic
1123563528 15:21516734-21516756 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123599780 15:21954021-21954043 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1123649453 15:22466822-22466844 CTAGGTGAGGCTGCAGGAGCTGG + Exonic
1123728979 15:23129451-23129473 CCAGGTGAGGCTGCAGGAGCTGG - Exonic
1123747143 15:23326916-23326938 CCAGGTGAGGCTGCAGGAGCTGG - Intergenic
1123762046 15:23440811-23440833 GGAGGAGAGGCTGCAGGAGCAGG - Exonic
1123762177 15:23441559-23441581 GGAGGAGAGACTGCGGGAGCAGG - Exonic
1123875521 15:24620304-24620326 CCTGAAGAGACTGCAGGAAGTGG - Intergenic
1124152176 15:27190984-27191006 CCAGTAGTCATTTCAGGAGCAGG + Intronic
1124279412 15:28350232-28350254 CTAGGTGAGGCTGCAGGAGCTGG - Intergenic
1124303286 15:28561376-28561398 CTAGGTGAGGCTGCAGGAGCTGG + Intergenic
1124545912 15:30626364-30626386 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1124779430 15:32615751-32615773 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1125723775 15:41857641-41857663 CCAGGAGCGACTGGAGGAGCTGG - Exonic
1126156494 15:45570328-45570350 CTAGGAAATACTGCAGGAGCTGG - Intergenic
1127774440 15:62254246-62254268 GCAGGAGAGGCTGCTGGAGCTGG - Intergenic
1128927684 15:71673749-71673771 CCAGTAGTCATTTCAGGAGCAGG + Intronic
1129029746 15:72609610-72609632 ACAGGAGAGGCTGCGGGAGCAGG + Intergenic
1129029754 15:72609652-72609674 GGAGGAGAGACTGCTGGAGCAGG + Intergenic
1129029756 15:72609670-72609692 GCAGGAGAGACTGCTGGAGCAGG + Intergenic
1129037970 15:72662409-72662431 AAAGCAGAGACTCCAGGAGCAGG + Exonic
1129203736 15:74022924-74022946 CCAGCAGCGACAGGAGGAGCTGG + Exonic
1129211919 15:74074822-74074844 AAAGCAGAGACTCCAGGAGCAGG - Exonic
1129220499 15:74129192-74129214 CCCGTAGCGACGGCAGGAGTAGG + Exonic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1129398484 15:75266262-75266284 AAAGCAGAGACTCCAGGAGCAGG + Exonic
1129402092 15:75290538-75290560 AAAGCAGAGACTCCAGGAGCAGG + Exonic
1129475628 15:75782977-75782999 AAAGTAGAGGCTCCAGGAGCAGG + Intergenic
1129729041 15:77919115-77919137 GGAGGAGAGACTCCAGGAGCAGG - Intergenic
1129729045 15:77919136-77919158 AAAGCAGAGACTCCAGGAGCAGG - Intergenic
1130473068 15:84240650-84240672 GCAGGAGACTCTGCAGGAGCTGG + Exonic
1130480482 15:84354715-84354737 GCAGGAGACTCTGCAGGAGCTGG + Intergenic
1130491230 15:84433044-84433066 GCAGTAGACTCTGCAGGAGCTGG - Intergenic
1130502813 15:84511844-84511866 GCAGTAGACTCTGCAGGAGCTGG - Intergenic
1130595357 15:85245258-85245280 GCAGGAGACTCTGCAGGAGCTGG + Intergenic
1131522482 15:93126899-93126921 CCAGTGGACACAGCTGGAGCAGG + Intergenic
1202958001 15_KI270727v1_random:95474-95496 ACAGTTAAGAATGCAGGAGCGGG + Intergenic
1202971886 15_KI270727v1_random:243871-243893 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1132739227 16:1403057-1403079 CCAGCAGAGCCTGCAGCAGCAGG + Intronic
1132939364 16:2499286-2499308 CCAGCGGAGGCTGCAGGAGGCGG + Intronic
1133912570 16:10079186-10079208 CTAGTAGGGACTGGAGGAGAGGG + Intronic
1134252600 16:12584980-12585002 TCATGAGAGACTGAAGGAGCAGG - Intergenic
1135920912 16:26648150-26648172 CCAGCAGGAACTGCAGGAGAAGG + Intergenic
1136020600 16:27437520-27437542 CCTGTGGAGGCTGCAGGAGGTGG - Exonic
1136578639 16:31139149-31139171 TCAGGAGAGTCAGCAGGAGCAGG + Exonic
1137406421 16:48192921-48192943 CCCGTGGACACTGCAGCAGCTGG + Intronic
1137782236 16:51107494-51107516 ACAGGAGACACTGCAGGAGATGG - Intergenic
1137977202 16:53041962-53041984 TCAGCAGAGCCTGGAGGAGCAGG - Intergenic
1137997200 16:53230936-53230958 CCATTAGAAAATGCAGGAGGAGG + Intronic
1138443939 16:57051562-57051584 CCAGTAGAGTCTCCAGGCTCTGG - Exonic
1139971846 16:70781286-70781308 CCTGTAGAGTCTGCAGAACCGGG + Intronic
1140521412 16:75585091-75585113 GGAGAACAGACTGCAGGAGCAGG - Intergenic
1140692980 16:77502218-77502240 CCAGAAGAGAAGGCAGGAGTAGG + Intergenic
1140699983 16:77572729-77572751 GCAGTGAAGACTGCAGGAGATGG + Intergenic
1141790269 16:86229703-86229725 CCACTAGTGAATGCTGGAGCTGG - Intergenic
1141923721 16:87153463-87153485 CCACTGGGCACTGCAGGAGCAGG - Intronic
1142003150 16:87675508-87675530 CCAGCAGACACTGCTGCAGCCGG + Intronic
1142030544 16:87836301-87836323 CCAAGTGTGACTGCAGGAGCCGG - Intronic
1142589676 17:997220-997242 CCACCAGGTACTGCAGGAGCAGG - Exonic
1143321001 17:6069148-6069170 ACAGCAGAGGCAGCAGGAGCAGG - Exonic
1144366173 17:14547065-14547087 GCAGTAGAGACTGAAGATGCAGG - Intergenic
1144784314 17:17823453-17823475 CCAGGAGAACCTGCAGGAGACGG + Intronic
1145403625 17:22568314-22568336 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1147318628 17:39632989-39633011 TGAGGAGAGGCTGCAGGAGCTGG - Intronic
1148460769 17:47837963-47837985 CCAGCAGAAACAGCAGGATCTGG - Exonic
1150384840 17:64750575-64750597 ACAGGTGAGCCTGCAGGAGCAGG - Intergenic
1150930354 17:69578183-69578205 CCCTTAGAGATTGCAGGAGAGGG - Intergenic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1151787471 17:76282122-76282144 GCAGGAGAGACGGCAGCAGCAGG + Intronic
1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG + Intergenic
1153618796 18:6957049-6957071 CCAGTCAAGGCTGCAGGAGGAGG - Intronic
1153759404 18:8316206-8316228 CCAGTAGAGACTGCAGGAGCTGG - Intronic
1154092515 18:11378658-11378680 CCTGCAGGGACTACAGGAGCCGG + Intergenic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1154172620 18:12062169-12062191 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1154450712 18:14473691-14473713 ACAGTTAAGAATGCAGGAGCGGG + Intergenic
1154485453 18:14868317-14868339 CCTCCAGAGACTGCAGGAGAAGG - Intergenic
1155021469 18:21900815-21900837 CAAGCAGAGACTGCAGCAGTAGG - Intergenic
1155332659 18:24733593-24733615 CCAGTAGCCCCTGCTGGAGCAGG - Intergenic
1156474092 18:37394814-37394836 CCAGTGGCCACTGCAAGAGCAGG - Intronic
1157327552 18:46679985-46680007 CCAGGAGGGACAGCAGGAGAGGG + Exonic
1157760551 18:50260713-50260735 CAGGTAGAGACTACAGCAGCAGG + Intronic
1159089014 18:63825281-63825303 CCCTTTGAGACTCCAGGAGCTGG - Intergenic
1159860425 18:73642101-73642123 CCAGAAAAGGCTGCATGAGCTGG + Intergenic
1160439999 18:78882560-78882582 CCACCAGAGACAGCAGGACCTGG - Intergenic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1162087118 19:8255603-8255625 CCAGGAGAGACAGCTGGGGCTGG - Exonic
1162392139 19:10396092-10396114 CCAGAGGAAACTGAAGGAGCTGG - Exonic
1163150945 19:15413679-15413701 ACAGTGGAGACCGCAGGGGCTGG - Intronic
1164402802 19:27913297-27913319 CCAGCAGAGACTACAGCAGTGGG - Intergenic
1165327998 19:35125324-35125346 CCTGGAGCCACTGCAGGAGCTGG - Exonic
1165364701 19:35358412-35358434 CCAGCTGAGACTGCATGAGGAGG + Intergenic
1165774595 19:38397174-38397196 CCAGGAGGGACTGCAAGAGAGGG - Intergenic
1166128866 19:40733440-40733462 CCACGAGAGAGTGCAGGAGACGG + Intronic
1166229089 19:41415126-41415148 GCAGTAGACAGTCCAGGAGCAGG - Intronic
1166337038 19:42114560-42114582 CCACCAGAGACTCCAGCAGCAGG - Intronic
1166777594 19:45322420-45322442 CTAGCAGAGTCTGCAAGAGCAGG - Intronic
1166856900 19:45786718-45786740 CCAGTACAGCCTGCTGAAGCAGG - Exonic
1166959614 19:46489668-46489690 CCAGCACAGGCTGCAGCAGCCGG - Intronic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1167962062 19:53114079-53114101 CCACAAGAGACTCCAGGAGAAGG + Intronic
1168567204 19:57435238-57435260 CCAGAAGACACTGCGGGGGCAGG + Intronic
1168689576 19:58368669-58368691 CCAGGAGAGGCTGCAGGCGACGG - Exonic
925082114 2:1078559-1078581 CAGGGAGAGACTGCAGGTGCCGG + Intronic
925297859 2:2790061-2790083 CCAGCAAAGTCTTCAGGAGCAGG - Intergenic
928266856 2:29819297-29819319 GCAGTAGTGACTGCAGAATCTGG - Intronic
928379077 2:30802709-30802731 CCAGTGGACCCTGCAAGAGCTGG - Intronic
933594545 2:84269574-84269596 CAAGCAGAGACTGGAGGAGTAGG - Intergenic
933832802 2:86224407-86224429 CCAGTAGAGACTGTCAGAGCTGG + Intronic
934051336 2:88213784-88213806 CCAGTACACACTGCAGCACCTGG - Intergenic
935617690 2:105102903-105102925 CACGGAGGGACTGCAGGAGCAGG + Intergenic
936152377 2:110028802-110028824 CCAGCAGAGAGTGCCAGAGCTGG + Intergenic
936192302 2:110342610-110342632 CCAGCAGAGAGTGCCAGAGCTGG - Intergenic
936955606 2:118019307-118019329 CCAGTAAGGACTTCAGCAGCAGG + Intergenic
937675846 2:124589207-124589229 ACATTAGTGACTGCAGGGGCTGG - Intronic
937739117 2:125328126-125328148 CCAGGAGTGAGTGCAGAAGCTGG + Intergenic
938422686 2:131156892-131156914 ACAGCAGGGACGGCAGGAGCGGG + Intronic
938710264 2:133970654-133970676 CCAGGAGATGCTGCAGCAGCTGG - Intergenic
939420843 2:141966504-141966526 CTATTAGATGCTGCAGGAGCTGG - Intronic
941444382 2:165582535-165582557 CCGGAAGAAACTGAAGGAGCTGG + Intronic
941866976 2:170345062-170345084 GCAGCAGAGACTGGAAGAGCAGG - Intronic
942296729 2:174524680-174524702 CCAGTAGAGATTGGAGGAGAAGG - Intergenic
946363744 2:219235797-219235819 GCAGCAGAGGCAGCAGGAGCAGG + Exonic
947985303 2:234442457-234442479 ACAGCAGAGACTGCAGGCCCAGG - Intergenic
948226081 2:236310224-236310246 CCAGGAGAAAAGGCAGGAGCTGG + Intergenic
948626471 2:239272109-239272131 CCATTAGACACTGCAGAAGCTGG + Intronic
948883188 2:240870681-240870703 CCACTACACACTGCAGGAGGTGG + Exonic
949037294 2:241821704-241821726 CCTGTAGAGCCTGCAGAACCGGG + Intergenic
1168966538 20:1901883-1901905 CCAGGAGGGACGGCTGGAGCAGG + Intronic
1169713330 20:8589065-8589087 CCAGTACAGGCTCCAAGAGCAGG + Intronic
1169933536 20:10858691-10858713 GCAGTGGAAACTGCAAGAGCAGG + Intergenic
1170010040 20:11712942-11712964 CCAGTAGATGCTGCATGGGCTGG - Intergenic
1170651319 20:18245269-18245291 GCAGGAGAGCCAGCAGGAGCAGG + Intergenic
1172552950 20:35815998-35816020 CCAGACTAGACTGCAGGGGCTGG + Intronic
1172562546 20:35902279-35902301 CCAGTAGAAATAGCAGGTGCTGG + Intronic
1172818727 20:37712682-37712704 CCAGCAGAGACAGCAGAGGCAGG - Intronic
1173627846 20:44486899-44486921 CCAGTAGAGAGAGCAGAACCAGG + Intronic
1173716810 20:45215153-45215175 CCAGCTGGGACTACAGGAGCCGG - Intergenic
1174449259 20:50609599-50609621 CCGAGAGAGCCTGCAGGAGCTGG - Exonic
1174480674 20:50829077-50829099 CCAGTGGGCACAGCAGGAGCTGG - Intronic
1176445521 21:6816883-6816905 ACAGTTAAGAATGCAGGAGCGGG - Intergenic
1176795883 21:13371160-13371182 CCTCCAGAGACTGCAGGAGAAGG + Intergenic
1176823689 21:13681916-13681938 ACAGTTAAGAATGCAGGAGCGGG - Intergenic
1179656655 21:42850202-42850224 CTTGTAGAGACTGCTGAAGCTGG + Exonic
1181556137 22:23672642-23672664 CAAGGAAAGACTGCAGGGGCTGG + Intergenic
1182048348 22:27294374-27294396 CCACTAGAATCTGCAGGATCTGG - Intergenic
1182503055 22:30762607-30762629 CCAGTGAAGACAGCAGAAGCTGG - Intronic
1184175342 22:42785803-42785825 AGAGGAGAGGCTGCAGGAGCTGG + Intergenic
1184315844 22:43688552-43688574 TCAGTAGGAAGTGCAGGAGCAGG - Intronic
1185233702 22:49699112-49699134 CCAGGAGAGACAGCATCAGCAGG + Intergenic
1185233939 22:49700191-49700213 TCAGGAGAGACTGCAGGAACTGG - Intergenic
949217156 3:1583627-1583649 CCAGCATTGACTCCAGGAGCAGG - Intergenic
949256808 3:2058032-2058054 GCAGAAGAGAATGCAGGAGCAGG + Intergenic
949896198 3:8768904-8768926 CCAGCAGGGACTGCAGAACCGGG - Intronic
950454659 3:13085536-13085558 CCAGCAGAGCCTGCAGGAGACGG + Intergenic
950711325 3:14814804-14814826 ACAGGAAAGACTGCAGGTGCTGG - Intergenic
952262608 3:31755072-31755094 CCAGTAGAGGCTCCAGAGGCAGG - Intronic
953141872 3:40236764-40236786 ACAGTTGACTCTGCAGGAGCTGG - Intronic
953404362 3:42653330-42653352 CCAGGAGATACTGCTGCAGCTGG + Intergenic
953470681 3:43163509-43163531 CCAGGAAACAGTGCAGGAGCAGG + Intergenic
953992500 3:47495215-47495237 CCTGTGAAGACTGCAGGAGGTGG - Intergenic
954146732 3:48638129-48638151 ACAGGAGAGACTCCAGGAGTGGG - Exonic
954660460 3:52224273-52224295 CCAGGAGAGACAGCGGGTGCAGG + Exonic
954891503 3:53934430-53934452 CTAGTAGAGACTGGTGGAGGCGG + Intergenic
955228660 3:57080349-57080371 CCTGTAGTGACAGCAGCAGCTGG + Intergenic
961285260 3:125797344-125797366 CCAGTTGAGATTGATGGAGCTGG + Intergenic
961352623 3:126313672-126313694 CCAGTAGGGAGGGCAGGAGAAGG - Intergenic
963384985 3:144581307-144581329 CCAGGAGAGACTAAAGGAGTGGG + Intergenic
963984183 3:151572987-151573009 CCAGTAAATAATGCAGGAGCAGG + Intergenic
966282845 3:178254827-178254849 CAACTGGATACTGCAGGAGCTGG - Intergenic
968595227 4:1478915-1478937 CCAGGAGCATCTGCAGGAGCGGG + Intergenic
970197195 4:13562928-13562950 CCAGTCCAGACTGCATGAGGAGG + Intergenic
970301777 4:14688877-14688899 TCGGTAGACACAGCAGGAGCTGG - Intergenic
970753519 4:19395795-19395817 CCAGTAGTCAATTCAGGAGCAGG - Intergenic
974858898 4:67495940-67495962 CCAGCAGAGATTGAAGGAGAAGG - Intronic
977551826 4:98450720-98450742 GCAGAAGAGATGGCAGGAGCAGG + Intergenic
979551652 4:121998070-121998092 CCAGCAAAGACTGGAGCAGCAGG - Intergenic
981695931 4:147558654-147558676 CCAGTCTAGACTGCAGCAGGAGG + Intergenic
982470303 4:155781445-155781467 ACAGGAGAGACTGCATAAGCAGG - Intronic
987328370 5:16833017-16833039 CCAGTAGAGGCAGGAGGAGGTGG - Intronic
987563374 5:19553682-19553704 CCAGTCTGGACTGCAGCAGCAGG + Intronic
988391540 5:30640126-30640148 CCAGTAGGGAATGAAGGAGAGGG - Intergenic
989360885 5:40599973-40599995 GCTGTAGAGACTGGAGGAACAGG - Intergenic
991228545 5:64302173-64302195 CCAATATACACTGCTGGAGCAGG + Intronic
991278535 5:64882286-64882308 CAAATAGAGACTTCAGGAGAAGG + Intronic
991684096 5:69166109-69166131 CCAATAGAGACTCCTGGCGCTGG - Intergenic
994366830 5:98927560-98927582 CCAGTAGACTCTGCAAGAACAGG + Intronic
996656448 5:125942529-125942551 CCTGTACAGCCTGCAGAAGCAGG + Intergenic
997356267 5:133265058-133265080 CCAGTAGGGACTGCAGCATTTGG + Intronic
997487989 5:134248030-134248052 CCAAGAGACACTGCAGGAACAGG - Intergenic
999040006 5:148398512-148398534 ATAGTAGAGTTTGCAGGAGCAGG + Intronic
999069306 5:148726636-148726658 CCAGCAGCAACTCCAGGAGCAGG - Intergenic
999621252 5:153476667-153476689 CAAGGAGAGATTTCAGGAGCCGG - Intergenic
1001032619 5:168273804-168273826 CAAGTAGAGACAGGAGGATCAGG + Intergenic
1002613564 5:180436623-180436645 CCAGGAAAGGCTGCAGGAGGCGG + Intergenic
1002676261 5:180915608-180915630 CCAGTACAGACTAGAGGAGGAGG + Intronic
1003236969 6:4303395-4303417 CCAGCAGAGACTGTTGGGGCTGG - Intergenic
1004356632 6:14934873-14934895 CCACTAGAGTCTGCAGGAATGGG - Intergenic
1005432385 6:25771777-25771799 CTAGTGGAGACTGCAGGACAGGG + Intronic
1006279256 6:33035269-33035291 CCAATAGAGACTACAGCAACAGG - Intergenic
1007686169 6:43668567-43668589 CCAGTAGATAATGCAGGGGGCGG - Intronic
1010360433 6:74987070-74987092 CCTTTAGCAACTGCAGGAGCTGG - Intergenic
1012253725 6:97008559-97008581 CCAGGAGAGGTGGCAGGAGCAGG - Intronic
1017011295 6:150065444-150065466 CAATGAGAGACTGCAAGAGCTGG - Exonic
1017105476 6:150883886-150883908 CCGGTAGACCCTGCAGGGGCTGG + Intronic
1018242488 6:161791687-161791709 CCAGTAGAGTGGGCAGGAGAGGG + Intronic
1018416716 6:163608012-163608034 CCGGTAGAGAGAGCAGCAGCCGG + Intergenic
1019383516 7:740589-740611 CCAGGAGGGACTGGCGGAGCTGG + Intronic
1021114141 7:16729531-16729553 TCAGCAGAGACTGCAGTAGCTGG + Intergenic
1021902898 7:25305160-25305182 CCAGTGGAGGCTGCTGGAGGGGG - Intergenic
1022310812 7:29194534-29194556 CCAGGAGAGGGTGCGGGAGCTGG + Exonic
1023072139 7:36446436-36446458 CCAGTACAGCCTGCAGAATCAGG - Intronic
1023597773 7:41850599-41850621 TCAGAAAACACTGCAGGAGCTGG - Intergenic
1023778903 7:43637369-43637391 CTTGTAAAGACTGCAGGAGAGGG - Intronic
1023990488 7:45125615-45125637 GCAGGAGCGGCTGCAGGAGCTGG + Intergenic
1024586316 7:50844949-50844971 CCTGTACAGCCTGCAGAAGCAGG + Intergenic
1024633614 7:51268965-51268987 CCAGAAGACACAGCTGGAGCTGG + Intronic
1027359396 7:77392627-77392649 CAAGGAGAGACAGCAGGATCAGG + Intronic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1029062544 7:97813214-97813236 CCAGTAGTCACTTCAGGAGCAGG - Intergenic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1029503601 7:100949214-100949236 TCAGGAGAGGCTGCAGGAGTAGG + Intergenic
1030359347 7:108579325-108579347 TCCATGGAGACTGCAGGAGCCGG + Intergenic
1032854119 7:135820041-135820063 GCAGTAAGGAGTGCAGGAGCAGG - Intergenic
1034858173 7:154573369-154573391 CCAGTAGCTGCTGCAGCAGCAGG + Intronic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1036012998 8:4749083-4749105 CGAGTGGAGACTGCATGGGCAGG - Intronic
1036254385 8:7193532-7193554 CTAGTAGACACTGCAGGATGAGG + Intergenic
1036363110 8:8093956-8093978 CTAGTAGACACTGCAGGATGAGG - Intergenic
1036895453 8:12631225-12631247 CTAGTAGACACTGCAGGATGAGG + Intergenic
1036987416 8:13550732-13550754 CCAGTAGTAACTGCAGTAACTGG - Intergenic
1037727831 8:21497891-21497913 CCAGGAGAGAATCCTGGAGCAGG + Intergenic
1040443815 8:47473046-47473068 CCTGGAGAGAGTGCAGGGGCTGG - Intronic
1041147014 8:54887591-54887613 ACAGTAGATACTGCAGGGGAGGG - Intergenic
1042646246 8:70989597-70989619 CCAGTAAAGAATGCAGGCTCTGG + Intergenic
1043473735 8:80585946-80585968 CCAGCAGTGACAGCAGGAGCAGG + Intergenic
1045388508 8:101692780-101692802 CCAATAGAGACGGTAGGAGGCGG - Exonic
1045514858 8:102849956-102849978 AGAGTAGTGGCTGCAGGAGCTGG + Intronic
1045849304 8:106674022-106674044 CCAGTAGAGACTCTAGGTGGGGG - Intronic
1046818902 8:118615386-118615408 CCAGTGGAGGCTGCAGGGGAGGG + Intronic
1047538019 8:125737025-125737047 CCAGTAGTGAGGGCAGAAGCCGG + Intergenic
1048340176 8:133532815-133532837 CCAGAAGAGTCCGCAGGTGCTGG + Intronic
1049162519 8:141106313-141106335 CCAGTGTAGCCTGCAGGAGTTGG + Intergenic
1049380739 8:142314562-142314584 CCAGAAGAGGCTGCCGGGGCCGG + Intronic
1049698284 8:143994291-143994313 CCTGGAGATAATGCAGGAGCAGG - Intronic
1051278343 9:15418057-15418079 CCAGTAGAGACAGGGGGAGGGGG - Intergenic
1052196323 9:25719371-25719393 CCAGGATAGACTGCAGTAGTGGG + Intergenic
1054225392 9:62454638-62454660 CCACCAGAGACCGCAGGAGAAGG - Intergenic
1057026340 9:91736614-91736636 AGAGTAGAGACAGCAGGAGGAGG + Intronic
1057549566 9:96042091-96042113 GCAGTAAAGACTGTAGGACCTGG + Intergenic
1058724016 9:107784910-107784932 CCAGGTCAGGCTGCAGGAGCTGG + Intergenic
1059329399 9:113525372-113525394 CCAATTTAGACTGCAGGAGAAGG - Intronic
1060522248 9:124300485-124300507 CCAGGTGAGACAGCAGGAGGCGG + Intronic
1060530238 9:124343536-124343558 CCTTTAGGGACTGCAGGAGTGGG - Intronic
1203523674 Un_GL000213v1:67642-67664 ACAGTTAAGAATGCAGGAGCGGG + Intergenic
1185570700 X:1132788-1132810 TCAGAAGAGAGTGCAGAAGCCGG + Intergenic
1185664025 X:1750051-1750073 CCCTTAGACACTGCAAGAGCTGG - Intergenic
1185954322 X:4472741-4472763 CCAGAGGAAACTGCAGGTGCTGG - Intergenic
1186149710 X:6661255-6661277 CCTGTAGATACTGCTGCAGCTGG + Intergenic
1187275481 X:17813249-17813271 CAAGGAGAGATTGGAGGAGCTGG - Intronic
1188486464 X:30687529-30687551 CCAGGAGAAACTGGAGCAGCTGG - Intronic
1188577305 X:31667132-31667154 CCAGTAAAGACTGAAGGAGGAGG - Intronic
1188975559 X:36669812-36669834 TCAGGAGAAACTGAAGGAGCTGG + Intergenic
1189439787 X:41024982-41025004 CCACTACACACTGCAGGAGCTGG - Intergenic
1189594228 X:42547489-42547511 CCAGTACAGCCTGCAGAACCAGG - Intergenic
1189641150 X:43072058-43072080 CCACTAGAAACTCCAGGAGATGG - Intergenic
1192216010 X:69158587-69158609 CCACAAGACACTGCAGTAGCAGG + Intergenic
1196389974 X:115196604-115196626 CCAGCTGAGACTGTAGAAGCAGG - Intronic
1197915626 X:131531064-131531086 CCTGTATAGACTGCAGAAGCAGG + Intergenic
1198196738 X:134370938-134370960 GCAGTAGATGCTGCTGGAGCAGG + Intergenic
1198315743 X:135464456-135464478 CTTGTAGAGACTGCTGAAGCTGG + Intergenic
1200762627 Y:7054087-7054109 CCAGGAGAAACTCCAGGAGAAGG - Intronic
1202373420 Y:24213168-24213190 ACAGGAGAGGCTTCAGGAGCAGG - Intergenic
1202497361 Y:25456952-25456974 ACAGGAGAGGCTTCAGGAGCAGG + Intergenic