ID: 1153760692

View in Genome Browser
Species Human (GRCh38)
Location 18:8329007-8329029
Sequence ATGTTGTTATAGATGCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153760692 Original CRISPR ATGTTGTTATAGATGCCATA AGG Intronic
901108416 1:6775934-6775956 AAGTTGTGACAGAGGCCATAGGG + Intergenic
905805598 1:40874762-40874784 ATGTTTTTATATATGCTACATGG + Intergenic
905998967 1:42407226-42407248 ATGTTGTTATATATCTAATAAGG - Intronic
907935678 1:59040112-59040134 ATTTTGTTATAGTAGCCAAATGG - Intergenic
908655356 1:66382684-66382706 AAGTTACTATAGATACCATATGG + Intergenic
909124559 1:71650008-71650030 ATTTTGTTTTATATTCCATATGG - Intronic
909216236 1:72893579-72893601 ATGTTGTTAAAGATGCCCACAGG + Intergenic
911975015 1:104481191-104481213 AAGGTGTTATAGATGCAAAATGG - Intergenic
915652550 1:157326927-157326949 ATTTTGTTATAGCTGGAATATGG + Intergenic
918653127 1:186990520-186990542 ATGGTGATATACAGGCCATAGGG - Intergenic
918703934 1:187638098-187638120 AAGTTTATATAGATGCCATCAGG + Intergenic
918985137 1:191615705-191615727 ATATTGAGATATATGCCATAGGG + Intergenic
920588326 1:207191145-207191167 GTGTTCTGATAGATGGCATAAGG - Intergenic
921811653 1:219521474-219521496 ATTTTGGTACAGATGCTATAAGG - Intergenic
1064279089 10:13934814-13934836 ATTTTGTTATAGAAGCCCAAGGG - Intronic
1066597641 10:37068936-37068958 ATGTTATTATAGATGCTTGAAGG - Intergenic
1067916465 10:50404795-50404817 ATGTTTTAATAGTTGCCATTGGG - Intronic
1068894060 10:62180109-62180131 TTGTTGTTGTAGATGCCTTTAGG + Intergenic
1070992770 10:80746827-80746849 CTGTTTATATAGATGCCATTGGG + Intergenic
1073973949 10:109078096-109078118 ATGTTGTTATCCAGTCCATAAGG + Intergenic
1075880265 10:125845196-125845218 GTGTTCTTATAGATGTCAGATGG + Intronic
1078753015 11:14182832-14182854 ATGTTGTTTCAGATGCCAAGTGG + Intronic
1079874607 11:25840947-25840969 ATGTTGTGGTACATGGCATATGG - Intergenic
1081351563 11:42059249-42059271 ATTTTGTTATAGATGACATTTGG - Intergenic
1083004156 11:59325605-59325627 ATGTTGATATAGAAGACTTAAGG + Intergenic
1085063259 11:73468416-73468438 ATGTTCTTAGGGTTGCCATAAGG + Exonic
1085268187 11:75250307-75250329 ATGTGGTTATAGTTGCCTGAAGG + Intergenic
1085868948 11:80326772-80326794 AGGTTGTTAAAGATGATATATGG - Intergenic
1085892161 11:80593453-80593475 ATGTTATTATAGATGCTTGAAGG + Intergenic
1086566322 11:88230971-88230993 ATGTGGTTGTAGCTGCCATCTGG - Intergenic
1090001449 11:122963387-122963409 AAGTTATTTTAGATGCCACATGG - Intergenic
1106985946 13:35350324-35350346 TTGTTGTTATTGATTCCCTAAGG + Intronic
1109151145 13:58848595-58848617 ATGTTGTTATAGATGGTAATGGG + Intergenic
1112590628 13:100760945-100760967 ATGTTATTAATGATACCATAAGG - Intergenic
1113121442 13:106927795-106927817 ATATTGCTATAGAGGCCACATGG - Intergenic
1117669500 14:58092460-58092482 AATTTGTTATAGCAGCCATAGGG - Intronic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1120316214 14:82896680-82896702 TAGTTGTGACAGATGCCATATGG + Intergenic
1121047758 14:90800402-90800424 ATGTTGTTTTACATGGCAAAAGG + Intronic
1121626000 14:95385817-95385839 ATGTTGTTCTAGTTCCCACAAGG - Intergenic
1124785528 15:32675958-32675980 ATGATGCTATGGATGCCATTTGG - Intronic
1129746570 15:78025858-78025880 ATTTTGTTATAGTTTCCAAAAGG - Intronic
1131323446 15:91420399-91420421 GTGTGTTTAGAGATGCCATATGG + Intergenic
1131487779 15:92836487-92836509 ATGTTATTAATGATACCATAAGG - Intergenic
1133455919 16:5942483-5942505 ATGTTGTTACAGGTGCAATTGGG + Intergenic
1135787610 16:25364379-25364401 ATGTTCTTATAGGTTCCAGAGGG + Intergenic
1136530605 16:30866033-30866055 TTGTTGTTATAAAACCCATATGG - Intronic
1137647230 16:50086479-50086501 ATGTATTTATAGTTGCCATGGGG + Intronic
1141305566 16:82860152-82860174 ATGTTAACATAGATGCCATTTGG - Intronic
1143500303 17:7334997-7335019 ATGTTGTCATTGTTGCCATCAGG - Intergenic
1145720510 17:27066998-27067020 CCTATGTTATAGATGCCATAAGG - Intergenic
1147649945 17:42056134-42056156 ATGTTGCAATGGATGCCATGGGG + Intronic
1153253855 18:3150696-3150718 CTATTGTTGGAGATGCCATATGG + Intronic
1153391289 18:4563043-4563065 ATATAGTTATATATACCATAAGG + Intergenic
1153760692 18:8329007-8329029 ATGTTGTTATAGATGCCATAAGG + Intronic
1159156937 18:64596427-64596449 ATGTGGTTATTGATGTCATCTGG - Intergenic
1160282512 18:77504813-77504835 ATGATGTTATAGAATACATATGG - Intergenic
1164038815 19:21476305-21476327 ATATTTCTATAGATGACATACGG - Intronic
927742863 2:25588306-25588328 ATGTTGTTATAAATGCAGAAAGG - Intronic
929716321 2:44314539-44314561 ATGAAATTATAGATGCCACATGG + Intronic
930617555 2:53609195-53609217 ATGTAGTTATAGAGGACAGAAGG + Intronic
931158381 2:59661179-59661201 ATGTTGTTAAACATCCCATAAGG - Intergenic
934669632 2:96202563-96202585 ATGCTGTAATCGATGCCCTATGG - Intronic
935231111 2:101097062-101097084 ATGTTCTAAAAGAAGCCATAGGG + Intronic
935827006 2:106962148-106962170 ATGCTGTTATACATCCCACAAGG + Intergenic
940112324 2:150168445-150168467 ATTTTGTTATAGTAGCCAAAAGG + Intergenic
943482879 2:188443429-188443451 ATGTTGATTTAAATACCATAGGG - Intronic
944538344 2:200733225-200733247 TTGTATTTATAGATGCCATCAGG - Intergenic
944634617 2:201662969-201662991 TTGTTATTATTGATGACATATGG - Intronic
946439052 2:219679634-219679656 ATTTTGTTATAGCAGCCCTAAGG - Intergenic
946951177 2:224877042-224877064 ATGTTCTTATTGCTGCCACAAGG + Intronic
947180465 2:227406882-227406904 ATTTTTTTAGAGATGCCATCTGG + Intergenic
948769143 2:240239205-240239227 TTGATGTTATATATGCCAGAAGG + Intergenic
1168835845 20:876817-876839 AGGTTGGTATGGATCCCATAAGG + Intronic
1174253918 20:49239897-49239919 AAGTTCTGATACATGCCATAAGG + Intronic
1176587421 21:8601626-8601648 ATTTTCTTATAGTTGACATATGG - Intergenic
1177483467 21:21724052-21724074 ATATTATTATATATGACATACGG - Intergenic
1177544769 21:22542638-22542660 ATGTTATTAAGGAAGCCATAAGG - Intergenic
1180270252 22:10578623-10578645 ATTTTCTTATAGTTGACATATGG - Intergenic
1182762218 22:32731805-32731827 ATGATGTAGTAGAGGCCATATGG + Intronic
949139995 3:620430-620452 ATTTTCTTATAGTTGACATATGG + Intergenic
957225268 3:77435167-77435189 TTGTTGATATAGATAACATAAGG + Intronic
960190561 3:114699958-114699980 ATCTTATTTTAAATGCCATAGGG + Intronic
961058491 3:123808977-123808999 ACATTGTTAGAGATGCCACACGG + Intronic
962286380 3:134088732-134088754 CTGTTTTTATAGATCCCTTAGGG - Intronic
962972611 3:140418215-140418237 ATGTGGTTATAGTTGTCACAGGG - Intronic
964476412 3:157101644-157101666 ATGCTGTTGCAGATGCCATGAGG - Intergenic
965845535 3:172956844-172956866 ATATTGTTATTGATGCCAAATGG - Intronic
970701762 4:18749900-18749922 ATGGTTTTATAGAAGCCAAAGGG - Intergenic
972771602 4:42202539-42202561 ATGTTGTTAAAGCAGCCGTATGG + Intergenic
972853132 4:43074019-43074041 ATGTTTATATAGATGCCACTGGG + Intergenic
973101931 4:46283050-46283072 AAGTTGTTATAAAGGCCATAAGG - Intronic
973720496 4:53719004-53719026 ATTTTGTTATAGCAGCCAAATGG + Intronic
975943234 4:79673505-79673527 TTGTTGTGATAGACGCCATATGG - Intergenic
978311312 4:107387347-107387369 ATGTTTATATAGATGCCACTGGG + Intergenic
978350641 4:107817430-107817452 ATTTTTTTTTAGATTCCATAGGG - Intergenic
979910769 4:126363194-126363216 ATTTTCTTATAGATGGCTTAGGG + Intergenic
980920408 4:139080031-139080053 ATTTTGCTATAGATGACACAAGG + Intronic
981687791 4:147474445-147474467 ATTTTGTTATAGCAGCCAAATGG - Intergenic
982090998 4:151879855-151879877 CTGTTCTTACAGATGCCACAGGG - Intergenic
982850790 4:160313085-160313107 ATGATGTTTTAGATACGATAGGG - Intergenic
982930071 4:161393585-161393607 ATATTGGTCTAGATGCCAGAAGG + Intronic
983615851 4:169703986-169704008 TTGTTGTTATAGGTTCCATCAGG + Exonic
986296695 5:6445292-6445314 ATGTAGTTGTAGCTGCCATGTGG + Intergenic
990147030 5:52773672-52773694 ATTTTGTTATATATGCAAAAAGG - Intergenic
990240745 5:53813858-53813880 ATGTTATTATAGAATTCATAAGG + Intergenic
991988412 5:72313422-72313444 ATGATGTTATATATACCAAAGGG + Intronic
992581389 5:78181740-78181762 ATGTTGTTATAGATGTTTAAAGG - Intronic
994105874 5:95948134-95948156 ATGTTTTTAAAAATGCCATAAGG + Intronic
995422012 5:111978305-111978327 CTGTTGTTCTAGATTCCAAAGGG - Intronic
1004566024 6:16798527-16798549 ATGTTGTTAGAAGTGGCATAGGG - Intergenic
1007940823 6:45779672-45779694 ATGTGGGTATTGATGGCATAAGG - Intergenic
1010809550 6:80284689-80284711 ATGTTTTTAAAAATGCCTTAAGG + Intronic
1010969783 6:82250993-82251015 AGTTTATTATAGATGCCATGTGG - Intergenic
1011309348 6:85965004-85965026 CTGTTTCTATAAATGCCATATGG - Intergenic
1012856714 6:104510614-104510636 ATGATGTCATATATGCCATTAGG - Intergenic
1013949542 6:115763252-115763274 ATGTTGTTTTACATGCCAAAAGG - Intergenic
1014062962 6:117094118-117094140 ATGTTGAAAGAGATGCCAAAAGG - Intergenic
1014981228 6:127948557-127948579 GTGTTGGGAAAGATGCCATATGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016432682 6:144004124-144004146 TAGTTGTTATAGAGGCCATATGG - Intronic
1018711388 6:166500280-166500302 ATTTTGTTGCAGATGCTATAGGG + Intronic
1018910606 6:168099154-168099176 TTGTTGTTTTAGAAGCAATAGGG - Intergenic
1018990992 6:168673963-168673985 ATATTCTTCTAGATACCATAGGG + Intergenic
1020912370 7:14147687-14147709 ATGTTTTCAAACATGCCATAAGG - Exonic
1021301024 7:18973418-18973440 ATGTACTTATAGATGGTATATGG + Intronic
1023383600 7:39633021-39633043 AGCTAGTTATAGATGCCACAGGG + Intronic
1024186722 7:46956536-46956558 ATATTGATATAGCTACCATATGG + Intergenic
1028463044 7:91117652-91117674 CTGTTGTTATAGAGTCCATTTGG - Intronic
1028681241 7:93535597-93535619 ATGTTTTCATAGAGACCATAGGG + Intronic
1034524852 7:151651762-151651784 ATGTTGTCACAGATGACATCAGG + Intronic
1036434913 8:8724048-8724070 CTGTTGTTATAAAAGGCATAGGG + Intergenic
1039647898 8:39307134-39307156 ATTTTGTTATAGAAGCACTAAGG - Intergenic
1043534632 8:81189023-81189045 ATGTGGTTATAGACTCCTTAGGG - Intergenic
1045270019 8:100653709-100653731 ACTTTGTTATGGAAGCCATAAGG + Intronic
1045909909 8:107395013-107395035 ATATTATAATAAATGCCATAAGG + Intronic
1048423371 8:134299324-134299346 ATGTGGTTACAGATGTCAGATGG + Intergenic
1048571435 8:135660229-135660251 ATGTTGTTATAGCAGCCCTAAGG - Intergenic
1049865034 8:144929691-144929713 CAGTTGTGATAGATCCCATATGG - Intergenic
1050146000 9:2568359-2568381 ATGCAGTTATAAATTCCATAAGG - Intergenic
1050439004 9:5641066-5641088 GTTTGTTTATAGATGCCATAAGG + Intronic
1050481002 9:6086641-6086663 ATGTTTATATAGATGCCATTGGG + Intergenic
1055166014 9:73194803-73194825 ATTTCTTTATAAATGCCATAAGG + Intergenic
1055228693 9:74033305-74033327 AAGGTGTTATATGTGCCATATGG - Intergenic
1057604010 9:96485641-96485663 ATGTTGATAGGGATGCCATGGGG + Intronic
1057924978 9:99138109-99138131 ATCTTGTTATATATAACATAAGG - Intronic
1059791269 9:117643689-117643711 ATGTTGTTTGAGATGCAAGAAGG - Intergenic
1203617381 Un_KI270749v1:79808-79830 ATTTTCTTATAGTTGACATATGG - Intergenic
1187015320 X:15321584-15321606 ATGTTGCAATAGATGCCACTGGG - Exonic
1187618948 X:21029400-21029422 ATTTTGTTATAGTAGCCAAATGG - Intergenic
1187821355 X:23291566-23291588 ATCTAGTTATAGATGGAATATGG - Intergenic
1189670083 X:43399027-43399049 ATGTTTTTGTAGATTCCTTAAGG - Intergenic
1189820964 X:44870159-44870181 ACATTATTTTAGATGCCATAAGG - Intergenic
1192681476 X:73258152-73258174 ATGTTTATATAGATGCCATTGGG - Intergenic
1193234295 X:79087973-79087995 ATCTTATTATAAATGCCAAATGG + Intergenic
1194319035 X:92420202-92420224 TTTTTGTTATAGTTGTCATATGG + Intronic
1195228744 X:102824481-102824503 ATGCAGTTACAGATGCCACACGG + Intergenic
1195468084 X:105203094-105203116 ATGTAGGTATAGATGCCAGTAGG - Intronic
1196417647 X:115488850-115488872 AATTTGTTATAGCAGCCATAGGG + Intergenic
1196519726 X:116659446-116659468 ATGTTGGGATAGATCCCATGTGG - Intergenic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic
1197491866 X:127128057-127128079 CTGTTTTTATAGCTGCCTTATGG - Intergenic
1198209333 X:134502064-134502086 ATGTTGTGGGAGCTGCCATAAGG - Intronic
1200627170 Y:5533353-5533375 TTTTTGTTATAGTTGTCATATGG + Intronic
1201972216 Y:19810571-19810593 ATGTTTATATAGATGCCATTGGG - Intergenic