ID: 1153762803

View in Genome Browser
Species Human (GRCh38)
Location 18:8348092-8348114
Sequence TGTCATTTTGATTTCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153762803_1153762808 -10 Left 1153762803 18:8348092-8348114 CCACCCAAGAAATCAAAATGACA 0: 1
1: 0
2: 1
3: 39
4: 374
Right 1153762808 18:8348105-8348127 CAAAATGACATGGTTTTTAAGGG 0: 1
1: 0
2: 0
3: 44
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153762803 Original CRISPR TGTCATTTTGATTTCTTGGG TGG (reversed) Intronic
900017136 1:159780-159802 TGTCATTATTCTTTCTTGGCGGG + Intergenic
900047395 1:518376-518398 TGTCATTATTCTTTCTTGGCGGG + Intergenic
900069609 1:760245-760267 TGTCATTATTCTTTCTTGGCGGG + Intergenic
901622928 1:10603592-10603614 TCTCATTTTGGTTTCTTGTCTGG + Intronic
902249598 1:15145562-15145584 TGTCATTGTGTGTACTTGGGTGG - Intergenic
902354427 1:15886880-15886902 TTTTATTTTGGTTTCTTAGGTGG + Intronic
902900848 1:19514875-19514897 TGTTATTTCTATTTGTTGGGAGG + Intergenic
903545747 1:24122362-24122384 TTTTATTTTTATTTTTTGGGTGG + Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
903904903 1:26678281-26678303 TGTAATCTCGATTACTTGGGAGG - Intergenic
905068090 1:35200864-35200886 TCTCTTTTTTATTTCTTGAGAGG + Intergenic
905805873 1:40877305-40877327 TCTCATATTGAGTTCCTGGGGGG + Intergenic
906422756 1:45684679-45684701 TGAGATATTGATTTTTTGGGGGG - Intronic
906664983 1:47615012-47615034 TTGCACTTTGATTTTTTGGGGGG + Intergenic
908150262 1:61293484-61293506 TATCATGTTGAATTCTTGGATGG + Intronic
908394087 1:63709330-63709352 TGTAATTCTGACTACTTGGGAGG + Intergenic
909099858 1:71336849-71336871 TGTGATCTTGGTCTCTTGGGTGG - Intergenic
909364710 1:74805642-74805664 TGTCAATTTGATTCCTGGAGAGG - Intergenic
909730168 1:78879708-78879730 TGTCATGTTGATGTCATGAGGGG - Intergenic
909946777 1:81672327-81672349 TTTCATGTTGCTTTCTTGGATGG + Intronic
909961389 1:81848304-81848326 TTTTATTTTGATTTTTTTGGTGG + Intronic
910498126 1:87856224-87856246 TGTCACTTTCATTTCTTATGGGG + Intergenic
910868237 1:91807287-91807309 TGTAATTTGGATTTCTCAGGGGG + Intronic
910934124 1:92473417-92473439 TGTCATTTTCATTCACTGGGAGG + Intergenic
910944193 1:92570830-92570852 TAGCACTTTGATTTCTTTGGAGG + Intronic
911526207 1:98989675-98989697 TCTTATTCTGATTTCTTGGAAGG - Intronic
912247469 1:107975209-107975231 TTTCATTTTGATCTCTTATGTGG + Intergenic
912446802 1:109742556-109742578 TGGCCTTTTGCTTTCTTGGGAGG - Intronic
912481322 1:109984314-109984336 TGTCTTTTTGACTTCATAGGGGG - Intergenic
912536365 1:110375784-110375806 TTTCATTTTAATTTTTTAGGTGG + Intronic
912582175 1:110730452-110730474 TGTCTTGTGGATTTCTTTGGAGG + Intergenic
912868513 1:113281347-113281369 TGTCATTTCTATTGTTTGGGTGG + Intergenic
912992874 1:114506715-114506737 TGTTTTTGTGATTTTTTGGGGGG - Intronic
913567402 1:120086388-120086410 TTATATTTTGATTTCTTGAGGGG - Intergenic
913630734 1:120707158-120707180 TTATATTTTGATTTCTTGAGGGG + Intergenic
914288149 1:146247094-146247116 TTATATTTTGATTTCTTGAGGGG - Intergenic
914549185 1:148697840-148697862 TTATATTTTGATTTCTTGAGGGG - Intergenic
914617497 1:149373879-149373901 TTATATTTTGATTTCTTGAGGGG + Intergenic
915088196 1:153403065-153403087 TGTCATTTTGTCTGCTTGTGTGG - Intergenic
915096691 1:153467753-153467775 TGTCATTTTGTCTGCTTGTGTGG + Intergenic
916443330 1:164848711-164848733 TGTCACATTGACTGCTTGGGAGG + Exonic
916782060 1:168044311-168044333 TGTCATATTGTTATTTTGGGAGG - Intronic
919157760 1:193788314-193788336 TCTCATTCTGATTTCTTTGGGGG + Intergenic
920276999 1:204813848-204813870 TGTCAGTTTGGTTTCTGGAGGGG + Intergenic
920977791 1:210801858-210801880 AGTCATTCTAATTTCTTGGATGG - Intronic
921634229 1:217473872-217473894 TTTCATTTTTATTTCCTGAGGGG - Intronic
922104981 1:222505718-222505740 TGTCATTATTCTTTCTTGGTGGG + Intergenic
922265295 1:223978241-223978263 TGTCATTATTCTTTCTTGGCGGG + Intergenic
923134516 1:231106403-231106425 TGTCATTTAGATTTCCTGTCAGG + Intergenic
923583593 1:235243424-235243446 TGACATTGTTATTTCTTTGGTGG + Intronic
924230737 1:241959766-241959788 TGTCATTTTGAATGTTCGGGTGG - Intergenic
924347155 1:243083237-243083259 TGTCATTATTCTTTCTTGGTGGG + Intergenic
1064719600 10:18215569-18215591 TTTCATTTTTATTTCTTAAGAGG - Intronic
1065036827 10:21647876-21647898 TGTTTTTTTTATTTTTTGGGGGG + Intronic
1065613886 10:27500607-27500629 TGTCATTTTGACCACTTGGGTGG - Intergenic
1066414015 10:35202735-35202757 TGTCATTTTGATTTTATTGAGGG + Intronic
1066729194 10:38421638-38421660 TGTCATTATTCTTTCTTGGCGGG - Intergenic
1067816951 10:49486398-49486420 TCTCATTTTCCTTTTTTGGGAGG - Intronic
1068074049 10:52231979-52232001 GGTCATTTTGTTTTCTTTGCTGG + Intronic
1068311102 10:55276640-55276662 TGTGATTTTAATTTCTTGCATGG + Intronic
1068415318 10:56712869-56712891 CGTCATTTTGATTTTTTAGATGG - Intergenic
1068444840 10:57107903-57107925 AGTCATTTAAATTTTTTGGGGGG - Intergenic
1070233039 10:74592210-74592232 TGTCATTTTAAATTCTTAGCAGG - Intronic
1070313251 10:75288763-75288785 TGACACTTTGAATTCATGGGTGG + Intergenic
1070727643 10:78803159-78803181 TGCCATCTGGCTTTCTTGGGAGG + Intergenic
1071249407 10:83801883-83801905 TGCCATTTTGAATTCTTGGTCGG + Intergenic
1071442417 10:85713416-85713438 TGGCATTTTTCTTTCTTGGGAGG - Intronic
1076973736 11:155009-155031 TGTCATTATTCTTTCTTGGCGGG + Intergenic
1078462828 11:11528170-11528192 TGTCATTCAGTTTGCTTGGGTGG - Intronic
1079274095 11:19017511-19017533 TGTCCTCTTGTTTTTTTGGGAGG + Intergenic
1081602010 11:44501745-44501767 TGTAATCCTGATTACTTGGGAGG + Intergenic
1082169195 11:48981720-48981742 TGTCATTTTGGGTTCTGGGTTGG + Intergenic
1082764009 11:57152203-57152225 TTTTACTTTTATTTCTTGGGAGG - Intergenic
1083094416 11:60234783-60234805 TGCCATTTTGTTATTTTGGGGGG - Intronic
1085595997 11:77810552-77810574 TTTTATTTTTATTTTTTGGGGGG + Intronic
1085950213 11:81321568-81321590 TGCCATTTGGGTTCCTTGGGAGG - Intergenic
1086158758 11:83697118-83697140 TAACATTTTGAATTCTGGGGAGG + Intronic
1087310514 11:96536424-96536446 AGTAATTTTGTTTTCTTGGCTGG + Intergenic
1087673761 11:101135541-101135563 TGGCATTTCCATTTCTGGGGAGG - Intergenic
1087732348 11:101793231-101793253 TGTCATTTGCATTTCTGTGGTGG + Intronic
1087952229 11:104236739-104236761 TGTCATTTATATTTTTTGGATGG + Intergenic
1088326987 11:108610829-108610851 TTTCATTTTTTTTTCTTTGGAGG + Intergenic
1089074139 11:115724238-115724260 TGTCATTCTGATACTTTGGGAGG - Intergenic
1089098395 11:115939069-115939091 TTTCAGTTTGCTTTCTTGAGTGG + Intergenic
1089545537 11:119221644-119221666 TGTAATTTCGGTTACTTGGGAGG + Intronic
1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG + Intronic
1091577019 12:1747055-1747077 TGTTTTTTTTATTTTTTGGGGGG - Intronic
1092603534 12:10093555-10093577 TGTCAGCTTAGTTTCTTGGGTGG - Intronic
1092950267 12:13496459-13496481 TGTAATTTTTTTTTTTTGGGGGG + Intergenic
1093019107 12:14186616-14186638 TTTAATTTTAATTTGTTGGGAGG - Intergenic
1094753193 12:33438258-33438280 TGTCATTTTGATCTCCTGGCGGG - Intronic
1095129642 12:38524323-38524345 TGTTGTTTTTATTTTTTGGGGGG - Intergenic
1096905473 12:54931663-54931685 TGTCATGTTGATGTCATGAGGGG + Intergenic
1097424992 12:59433212-59433234 TGTGACTTTGATGCCTTGGGGGG + Intergenic
1098143790 12:67477726-67477748 TCTCATTTTGCTTTCTGGTGAGG - Intergenic
1099708301 12:86185920-86185942 TGCCATTTTTTTTTCTGGGGTGG - Intronic
1100614070 12:96217318-96217340 TGTGATTCTGATTTTTTGGAAGG + Intronic
1101734863 12:107455586-107455608 AGTCATTTTGAGTTTTGGGGTGG - Intronic
1102831191 12:116001563-116001585 TTTCATTGTCATTTCTTGGGAGG + Intronic
1103113392 12:118303002-118303024 TGATATTTTGATTGTTTGGGTGG - Intronic
1104129732 12:125881793-125881815 TCTCATTTTGAGTTCATGTGAGG + Intergenic
1104267694 12:127251735-127251757 ATTCATTTTGATAACTTGGGAGG + Intergenic
1104752954 12:131251593-131251615 TGTCATGTTGGTTTCCTGGCAGG - Intergenic
1105060776 12:133148456-133148478 TGTCATTTTGAGTTCTTCAGAGG - Intronic
1106099837 13:26684612-26684634 TGTGATTTTGATATTTTGGGTGG + Intronic
1106977420 13:35236999-35237021 TATTATTTTTCTTTCTTGGGAGG + Intronic
1107300873 13:38964361-38964383 TGTCTGTTTGTTTTCTGGGGTGG - Intergenic
1107468870 13:40673463-40673485 TGACATTTGGACTTTTTGGGGGG + Intergenic
1108017889 13:46095302-46095324 TTTAATTTTGATATCTTGGCTGG - Intronic
1108420963 13:50249063-50249085 TCTCATTTTGCATTCTTGGGAGG - Intronic
1109732982 13:66440411-66440433 TGTCTTTTAGATTTTTTGGCTGG + Intronic
1110785310 13:79517521-79517543 TGTAATTTTGATATCTTTGCCGG - Intronic
1111072004 13:83182503-83182525 TTTCATTTTTATTTCTTTTGTGG + Intergenic
1111367197 13:87264198-87264220 AGTCATGTTGATTCCTTGGTAGG - Intergenic
1111710445 13:91805784-91805806 AGTCATTTAGATTTCTAGGATGG + Intronic
1112335848 13:98515315-98515337 TTTCATTTTGACTTCGTGGATGG + Intronic
1112429605 13:99339142-99339164 TGTCTATTAGATATCTTGGGGGG - Intronic
1115209764 14:30954398-30954420 TCTTATATTGATTTCTTTGGGGG + Intronic
1115698971 14:35930302-35930324 TGTAATTTCAACTTCTTGGGAGG - Intronic
1118565288 14:67133608-67133630 TTTCAATTTGATTGCTTTGGGGG - Intronic
1118876751 14:69792462-69792484 TTTAAATTTGATTTCATGGGAGG - Intronic
1118933888 14:70268214-70268236 TGTCTCTTTGATTTCTTATGTGG - Intergenic
1119060875 14:71472535-71472557 TGTCATGATGCTTTTTTGGGTGG + Intronic
1119203307 14:72775228-72775250 TTTCATTTTGTTTTTTTGGGGGG - Intronic
1120193120 14:81457289-81457311 TGGCATTATAATTTCTTGAGGGG + Intergenic
1121648023 14:95534557-95534579 TGTCGTGTTGGTCTCTTGGGAGG - Intronic
1122101035 14:99409703-99409725 TATTATATTGATTTCATGGGGGG + Intronic
1124137744 15:27049595-27049617 TGTCATGTTCAGTACTTGGGAGG - Intronic
1124264734 15:28222482-28222504 AGTTATTTTGCTTTTTTGGGGGG - Intronic
1124362740 15:29050332-29050354 AGTCATTTTGTTTACTTAGGAGG - Intronic
1124879690 15:33630478-33630500 TCCCATTTTGAATTCTTTGGGGG + Intronic
1124968850 15:34464005-34464027 TTTCACTTTGATTGCTTGGCTGG - Intergenic
1125263653 15:37854792-37854814 CATCATTTTGGTTTCTGGGGAGG - Intergenic
1126625145 15:50679211-50679233 TGTCATTTTAGGTACTTGGGAGG + Intronic
1128049960 15:64655435-64655457 TATCATTCTGATTTTTTGCGGGG - Intronic
1128435320 15:67642152-67642174 TGGCATTTTTATTTGTTTGGTGG + Intronic
1129222586 15:74140252-74140274 TGTTATTTTGATGTCATGGGTGG - Intergenic
1129567461 15:76638095-76638117 TGTCTTTTTGCTTTCTTGATGGG + Intronic
1129886729 15:79043385-79043407 TTTGATTTTGATTTCTTGCAGGG + Intronic
1130097500 15:80866926-80866948 TGTCACTCTGCTTGCTTGGGAGG - Intronic
1130781801 15:87047648-87047670 TGTCATTTTTTTTTCTTTTGTGG - Intergenic
1131514952 15:93071281-93071303 TTTAATTTTGAATTCTTGGGAGG + Intronic
1131697926 15:94900442-94900464 TGTCATTTTTTTCTCTTGGTGGG + Intergenic
1132190426 15:99851394-99851416 TTTCACTTTGATTACTTGGCTGG + Intergenic
1134054898 16:11163878-11163900 TGACATTTTGATTTGTTAAGGGG + Intronic
1134332288 16:13262176-13262198 TTTTATTTTGTTTTCTTTGGAGG - Intergenic
1134485348 16:14653827-14653849 TGTCGTTTTAATTACTTGGGAGG - Intronic
1135655690 16:24246882-24246904 TGTAATCCTGATTACTTGGGAGG - Intergenic
1136849249 16:33600665-33600687 TGTCTTTTTAATTCCTCGGGAGG - Intergenic
1138066806 16:53950026-53950048 TTTCATTTTCTTTTTTTGGGGGG + Intronic
1139035031 16:62934972-62934994 TGTCATGTTGATTACTTAGAAGG + Intergenic
1139158400 16:64472968-64472990 TTTCAATTTGATTTCTTATGTGG - Intergenic
1139763397 16:69206116-69206138 TGTAATTCTCGTTTCTTGGGAGG - Intronic
1140552023 16:75876561-75876583 TTTCATTTTGATTGCTTTTGGGG + Intergenic
1140795031 16:78429404-78429426 TATCATGGTGATTTTTTGGGTGG - Intronic
1142446526 16:90142677-90142699 TGTCATTATTCTTTCTTGGTGGG - Intergenic
1203110956 16_KI270728v1_random:1449315-1449337 TGTCTTTTTAATTCCTCGGGAGG - Intergenic
1142460979 17:92788-92810 TGTCATTATTCTTTCTTGGCGGG + Intergenic
1142928537 17:3262059-3262081 TGTCATTGTGACCTCTGGGGTGG + Intergenic
1145803271 17:27705693-27705715 TATCATTCTGCTTTCTTCGGTGG + Intergenic
1146497851 17:33338727-33338749 TGACATTAAAATTTCTTGGGTGG + Intronic
1148485217 17:47986556-47986578 TGTGGATTTGATGTCTTGGGTGG - Intergenic
1148630424 17:49103933-49103955 TGTCCTTTTTTTTTCTTGGTTGG - Intergenic
1149401233 17:56297923-56297945 TGTAATTTTAATGGCTTGGGGGG + Intronic
1150136549 17:62698597-62698619 TATCAATTTGATTTCCTGGCAGG - Intergenic
1150826014 17:68475960-68475982 TGTGATGTTGATTTTTTGGGGGG + Intergenic
1152905328 17:82967227-82967249 CGACATTTTCACTTCTTGGGTGG + Intronic
1152994929 18:397619-397641 TGTCAGTTTGGTTTTTTGGGTGG + Intronic
1153762803 18:8348092-8348114 TGTCATTTTGATTTCTTGGGTGG - Intronic
1155291261 18:24344812-24344834 TTTGTTTTTGTTTTCTTGGGGGG + Intronic
1155881221 18:31150742-31150764 TGTCATTTTGATATTTTAGCTGG + Intronic
1158151738 18:54381780-54381802 TTTCATTTTAATGTTTTGGGTGG + Exonic
1158269270 18:55695384-55695406 TGTCATTTTGGTCTCCTGTGGGG + Intergenic
1158951899 18:62502764-62502786 TTTCATTTTTATTTTTTGGACGG - Intergenic
1159597637 18:70398004-70398026 TGTGTTTTTGATTTTTGGGGAGG - Intergenic
1160650680 19:225154-225176 TGTCATTATTCTTTCTTGGTGGG + Intergenic
1161793021 19:6372205-6372227 TGTCTTTTTGATTCCTCGGCCGG - Intergenic
1162385350 19:10357700-10357722 TGTCCTCTGGATTTCTTGGAGGG + Intronic
1164780980 19:30892437-30892459 TTTCAAATTGATTTGTTGGGTGG - Intergenic
1164914710 19:32043152-32043174 ATTCATTTTGTTTTTTTGGGGGG - Intergenic
1165031521 19:33001195-33001217 TGTCTTTTTAATTCCTTGGGAGG + Intronic
1167639888 19:50675111-50675133 TGTCATCTTAGTTACTTGGGAGG + Intronic
1168441249 19:56368983-56369005 TCTAATTTTGCTTACTTGGGTGG + Intergenic
925210060 2:2037783-2037805 TGTTTTTTTGTTTTTTTGGGGGG - Intronic
925666400 2:6261456-6261478 TGTGAGTTTGAGTCCTTGGGTGG - Intergenic
925753558 2:7111173-7111195 TGTCCTTTAGATATCTTGAGGGG + Intergenic
926590761 2:14738006-14738028 TGTCATTTTCTTTTATTGAGGGG - Intergenic
927913756 2:26920803-26920825 TTGCATTTTTATTTCTTGTGTGG + Intronic
927978110 2:27355697-27355719 TGTCATTATTTTTTCTTGGCTGG - Intronic
928151835 2:28837972-28837994 TGTCATTTTTAGTGATTGGGGGG - Intronic
928319005 2:30268541-30268563 TGGCATTTGGATTGCTGGGGAGG - Intronic
928535998 2:32242167-32242189 TATAATTTTGATTTCTGGGCTGG - Intronic
929135941 2:38623977-38623999 TGTCACTTTGGTTCCTTCGGAGG + Intergenic
930543816 2:52741872-52741894 TTACATTTTGATTCCTGGGGAGG - Intergenic
930693901 2:54391639-54391661 TGTGGTTTTGATTTCTTAGTAGG - Intergenic
932473617 2:71983245-71983267 TGTAATTTTGATAGCTTTGGGGG - Intergenic
932502040 2:72191349-72191371 TGTAATTCTGATTTCATGGAGGG + Intronic
932921579 2:75920904-75920926 AGTTATTTTTATTTCTTGGAAGG - Intergenic
933363351 2:81315675-81315697 TGTCTTTTTTATTTTTTTGGAGG - Intergenic
933497663 2:83070418-83070440 TGTCCTTTTGTATTCTTGGGTGG + Intergenic
933674639 2:85043854-85043876 TGTCATTTTGATTTTTTTTAAGG + Intronic
935314385 2:101816954-101816976 GCTCATTTTGAATTCTTTGGGGG + Intronic
935452601 2:103227399-103227421 TGTCATTTTTATTTCATTGAAGG + Intergenic
937603789 2:123772473-123772495 TGTGATTTTCATTTCTTGCCTGG + Intergenic
937699308 2:124846241-124846263 TTTCATCTTGATTTCATTGGTGG + Intronic
938593381 2:132761992-132762014 CATCATTTAGAATTCTTGGGGGG + Intronic
939437101 2:142191735-142191757 TGTAATTTGCATTGCTTGGGTGG - Intergenic
939627231 2:144492726-144492748 TGTTATTTTGAATACTTGAGTGG - Intronic
940063841 2:149604170-149604192 TGTCATATAGCTATCTTGGGAGG - Intergenic
940502131 2:154505866-154505888 TGTCATTCTGTATTCTTAGGAGG + Intergenic
940834796 2:158509079-158509101 TGTCATTTTAATTTTTGGTGGGG - Intronic
940912749 2:159223486-159223508 TGTCATTTTGAATAATGGGGTGG + Intronic
940994315 2:160131096-160131118 TGTCATATTGGTTTCATGGAGGG + Intronic
941737486 2:168994995-168995017 TCTCATTTAGAATTCCTGGGTGG + Intronic
941968613 2:171325382-171325404 TCTCATTTTGTTTTCTAGGCTGG + Intronic
943904356 2:193478646-193478668 ACTCATTTTATTTTCTTGGGGGG - Intergenic
944158388 2:196633442-196633464 TATCATTTTAATTTCTGTGGGGG - Intergenic
945263681 2:207869144-207869166 TGTCCTTTTGACTTTTTGAGGGG - Intronic
945975188 2:216264969-216264991 TTTCTTATTGATTTCTTGGGTGG + Intronic
947829120 2:233126294-233126316 TGTCATTAGGATTTCTTTGGGGG - Intronic
948494810 2:238340471-238340493 TACCATTTTGATTTTTTGGGTGG + Intronic
948687830 2:239680917-239680939 TTTTATTTTGATTCTTTGGGTGG + Intergenic
949000666 2:241610992-241611014 TGTTTTTTTTAATTCTTGGGAGG - Intronic
1169789502 20:9394247-9394269 TTTCATTTAGAATACTTGGGGGG - Intronic
1170142614 20:13140076-13140098 TGTCATTTTAATTTCTTCTGAGG - Intronic
1170201879 20:13753031-13753053 TGTCATTGGGATATCTTGGCAGG - Intronic
1174074952 20:47927869-47927891 TTTCATTCTGGTTGCTTGGGGGG - Intergenic
1174803382 20:53584237-53584259 TGCCTTTTGGTTTTCTTGGGTGG - Intronic
1177102358 21:16914225-16914247 GGCCATTTTCATTTCTTTGGTGG - Intergenic
1177641509 21:23849856-23849878 TGTTATTTTGATTGCTTGTTGGG + Intergenic
1177860062 21:26441687-26441709 TGTCATTTTGATTACTGGCTGGG + Intergenic
1179173471 21:38990857-38990879 TGTCATTTTGATTTTCCTGGAGG - Intergenic
1179900466 21:44390781-44390803 TGTCACTTTGAATTGTTGAGAGG + Intronic
1180561288 22:16616392-16616414 TGCCATTTGGTTTTCTTGGGTGG + Intergenic
1180938132 22:19639395-19639417 TGATGTTTTGATATCTTGGGAGG + Intergenic
1181615783 22:24053497-24053519 TGTAATTCTAATTACTTGGGAGG - Intronic
1182121801 22:27792242-27792264 ATTCATTTAGATTTCTTGTGAGG - Intronic
1183050800 22:35258773-35258795 TGGCATTTTGAGTTCTTGAAAGG + Intronic
1183051055 22:35261773-35261795 TGTCTTTTGCATTTTTTGGGGGG - Intronic
1184769022 22:46587323-46587345 TGACAGTTTCACTTCTTGGGTGG - Intronic
1185234271 22:49702927-49702949 TGCTTTTTTGATTTTTTGGGGGG + Intergenic
949270822 3:2214446-2214468 TGTCATTTTCTTTTCTTGAAAGG + Intronic
949733536 3:7143849-7143871 TTTCCTTTTCATTTCTTGTGAGG + Intronic
950804105 3:15582227-15582249 TGTCATATTGCTTTCTCTGGAGG - Intronic
953018611 3:39100064-39100086 TGTCATCTTCATTTCATGAGTGG - Intronic
956833342 3:73074792-73074814 TGACATTTTCATTTCTTCAGAGG + Intergenic
958510610 3:95042540-95042562 TGTGATTTTGATGTGTTTGGTGG + Intergenic
959273028 3:104238554-104238576 TGTCCTTTAGTTTTCTTTGGTGG + Intergenic
961646293 3:128394449-128394471 TGTCATTTTTATGACTTGGTGGG - Intronic
962086043 3:132192548-132192570 TTTCTTTTTCATTTCTTGGGGGG + Intronic
962644715 3:137425683-137425705 TGTCATTTTCATGTTTTGGGGGG - Intergenic
962901866 3:139768467-139768489 AATCATTTTGCTTTCTTGGACGG + Intergenic
963545788 3:146657485-146657507 TGTCATTTTGACTACTTTTGAGG - Intergenic
964020351 3:152002828-152002850 TGTCATTTTCATTTTTCAGGGGG - Intergenic
966810077 3:183835842-183835864 TGTAATTTTGATTTGTTTTGGGG - Intronic
968367152 3:198194835-198194857 TGTCATTATTCTTTCTTGGCGGG - Intergenic
969437190 4:7194906-7194928 TGTCATTTAGCTTCCTGGGGAGG + Intronic
969957440 4:10905639-10905661 TTTCATTTTTATTTCTTTAGTGG - Intergenic
971033748 4:22669907-22669929 TGCCATTTTGATATCTGAGGGGG + Intergenic
972033247 4:34489397-34489419 TGTCAATTTAATTTATTGGAAGG + Intergenic
972260109 4:37399244-37399266 TCACATTTTCATTTCATGGGTGG + Intronic
973218807 4:47702050-47702072 TCTCATTTAGGTTTCTTGGGAGG + Intronic
974257479 4:59478357-59478379 TATCATTCTGATTTCTCTGGAGG + Intergenic
974354146 4:60790307-60790329 AGTCACTGTGTTTTCTTGGGTGG - Intergenic
974416192 4:61609893-61609915 TTTCATTTCAATTTCTTTGGGGG - Intronic
975941450 4:79652041-79652063 ACTCATTTTAATTTGTTGGGTGG - Intergenic
977819688 4:101457884-101457906 TGTCATTATGATCTCAGGGGTGG + Intronic
977947391 4:102929246-102929268 TGTCTCTCTGTTTTCTTGGGAGG + Intronic
978424058 4:108563751-108563773 TGTAATTCTAATTACTTGGGAGG - Intergenic
979255561 4:118604442-118604464 TGTCATTATTCTTTCTTGGCGGG - Intergenic
979265206 4:118694340-118694362 TATTATTTTGTTTTCTTGGGAGG + Intronic
979332779 4:119436075-119436097 TGTCATTATTCTTTCTTGGCGGG + Intergenic
979447795 4:120835224-120835246 AGTTATTTTTATTTCTTTGGTGG - Intronic
980640928 4:135578200-135578222 TGTCATTTTTCTCTCTTGGGTGG + Intergenic
980835697 4:138189174-138189196 GGCCATTTTCATTTCTGGGGAGG - Intronic
981257550 4:142680253-142680275 TTTCCTATTGATTTCTTGGCTGG - Intronic
981321008 4:143391282-143391304 TGTTATTTTTATTTTTTGGAAGG + Intronic
981723548 4:147825074-147825096 TGTCACTCTAATTTCCTGGGTGG + Intronic
982152683 4:152479176-152479198 TGTCATTTGCATCTCTTAGGAGG - Intronic
982544876 4:156721848-156721870 AGTTTTTTTGATTTTTTGGGGGG + Intergenic
982827907 4:160023256-160023278 TGTCATCTTTCTTTCTTTGGTGG + Intergenic
983357657 4:166684238-166684260 TTTCAATTTGATTCCCTGGGTGG - Intergenic
983519839 4:168696659-168696681 TTTCATTTTTATTTCTTGGGTGG - Intronic
983704076 4:170636223-170636245 TGTCTTTTGTATTCCTTGGGTGG + Intergenic
984469712 4:180152702-180152724 ATTCATTTAGATTTCTTGGAAGG - Intergenic
985230783 4:187814353-187814375 TGCCATGGTGATATCTTGGGAGG + Intergenic
985330925 4:188832370-188832392 TGTCATTTTGTGTTCTTGAATGG - Intergenic
985929197 5:3042848-3042870 TGTCATTTTGCCATCTTGGTTGG - Intergenic
987757178 5:22111133-22111155 TTTCCTTTTATTTTCTTGGGTGG + Intronic
988829656 5:34975110-34975132 TTTCATTTGGATTTCTTTGATGG + Intergenic
988987999 5:36639733-36639755 AGTCATTTTTATTACTCGGGTGG + Intronic
989316281 5:40082611-40082633 AGTCAATTTGATTGCTAGGGAGG + Intergenic
989699205 5:44241319-44241341 TGCCATTTTTATCTCTTGTGTGG - Intergenic
990032133 5:51274585-51274607 TGTCATTTTGCTCTCTTCTGTGG - Intergenic
991069156 5:62457360-62457382 TGTCATTCTGGTTACTTGGGAGG + Intronic
993159026 5:84264426-84264448 TGACATTTTAAGTTCTTGTGTGG - Intronic
993653313 5:90548387-90548409 TGTCATTTTGCTTTAATGGCAGG - Intronic
995585478 5:113643812-113643834 TGTCAGGATGTTTTCTTGGGGGG + Intergenic
995636146 5:114193241-114193263 TGGCCTTTTGATTTCCTGGATGG + Intergenic
995883466 5:116867777-116867799 GGCCATTTTCATTTCTTTGGTGG + Intergenic
996335976 5:122384543-122384565 TGTCATTATAATTTCTTTTGTGG - Intronic
997736160 5:136214016-136214038 TGTCATTGTTATTTGTAGGGAGG + Intronic
998020291 5:138764415-138764437 TGTGAGTTTGATCCCTTGGGAGG + Intronic
998754887 5:145366452-145366474 TGTCATTTAGCTTATTTGGGGGG - Intergenic
999729353 5:154464386-154464408 TGGCATTCTGAGTTCTTGGACGG - Intergenic
999967698 5:156827078-156827100 CTTTATTTTGATTTCTTGGCTGG - Intergenic
1000439062 5:161245902-161245924 TGCCATTTTCATTTCTTTTGTGG - Intergenic
1001165691 5:169364137-169364159 TGTAATCTTGGTTGCTTGGGAGG + Intergenic
1002392077 5:178922047-178922069 TTTCATGATGTTTTCTTGGGTGG - Intronic
1002627686 5:180542599-180542621 AGTTATTTTGATTTCCTGGTAGG + Intronic
1002726375 5:181300032-181300054 TGTCATTATTCTTTCTTGGCGGG - Intergenic
1003038656 6:2667382-2667404 TGTCATTTTGATTTGGTCTGTGG - Exonic
1003179273 6:3778185-3778207 TTTCATTTTGTTTTCCTGGAAGG - Intergenic
1004687278 6:17959023-17959045 TGGCATGGTGATTACTTGGGAGG - Intronic
1006056479 6:31388888-31388910 TTTCATTTTGAATTTTTTGGGGG - Intergenic
1006769626 6:36541948-36541970 TGTCATCTTAACTACTTGGGAGG - Intronic
1007457023 6:41986549-41986571 TATTGTTTTGATTTCTTTGGGGG + Intronic
1007672002 6:43563299-43563321 TTTCATTTTGATTTTTTGTAGGG + Intronic
1008174278 6:48247619-48247641 TGTCATTTTTGTTTCTTGGCAGG + Intergenic
1008653933 6:53591825-53591847 AGTCATTCTGATTTTTTGAGTGG + Intronic
1009241447 6:61191186-61191208 TCTGATTTTTTTTTCTTGGGTGG - Intergenic
1009568372 6:65345727-65345749 TGTTTTTTTGAGGTCTTGGGAGG - Intronic
1010308780 6:74357772-74357794 TGACAGTTGGATTTCTTAGGAGG - Intergenic
1010652029 6:78467121-78467143 TGCCATTCTAATTTTTTGGGGGG - Intergenic
1010920677 6:81676307-81676329 AGTCCTCTTGATTTTTTGGGTGG - Intronic
1011057689 6:83223528-83223550 TGTGTTTTTGATTTCTTAAGAGG - Intronic
1011571662 6:88744027-88744049 TGGTATTTTTATTTCTTTGGGGG - Intronic
1011686096 6:89824917-89824939 TGTCAATTTTTTTTTTTGGGGGG + Intergenic
1012120650 6:95362234-95362256 TTTCAGTTTATTTTCTTGGGTGG - Intergenic
1012528752 6:100209156-100209178 TGTCATTTTGATTTCATTAGTGG + Intergenic
1012779485 6:103539412-103539434 AGTCATTTTCATATCTTGGTTGG - Intergenic
1013451085 6:110281796-110281818 TGTCATTTTGACTGCTTTTGGGG - Intronic
1016484480 6:144521291-144521313 TTTCATTTTTATTTTTTTGGGGG - Intronic
1018442249 6:163823932-163823954 TGTCAATTTGGTTTCTGAGGAGG - Intergenic
1018482708 6:164207745-164207767 TCTCATTTTGTTTGGTTGGGGGG + Intergenic
1018636474 6:165863884-165863906 TTACATCTTGATTTCTTGGTTGG - Intronic
1019844703 7:3486110-3486132 TGTAATTTTGATTTCTTCTATGG + Intronic
1020505522 7:8982404-8982426 TTTCATTTTGAGTTTCTGGGAGG - Intergenic
1020610590 7:10391842-10391864 GGTAATTAAGATTTCTTGGGAGG + Intergenic
1020730349 7:11871377-11871399 TGTGGTTATGATTTCTTGGCAGG + Intergenic
1021188742 7:17595740-17595762 AGTCATTTTGATTTCATAGTAGG - Intergenic
1021453886 7:20808105-20808127 TGTTATTTTTATTTTTTGAGAGG - Intergenic
1021722848 7:23520634-23520656 CGTCCTTGTCATTTCTTGGGTGG - Intronic
1021861597 7:24911228-24911250 TGTTATTTTAAGTTCTTGGGTGG - Intronic
1022539359 7:31121689-31121711 TGATATTTTGATTGCTTGAGTGG - Intergenic
1024028444 7:45433840-45433862 TGTCATTTTTTTTTCTTCAGTGG + Intergenic
1024071254 7:45787585-45787607 TGTCATTATTCTTTCTTGGTGGG - Intergenic
1027769474 7:82388619-82388641 TGGGATTTTGATTTCATGTGAGG + Intronic
1029603073 7:101581308-101581330 TGTAAAATTGATCTCTTGGGCGG - Intergenic
1029858497 7:103543522-103543544 TGTCATCTTGGCTACTTGGGAGG + Intronic
1030020202 7:105266821-105266843 TGTCTTTTTAATTTGTTTGGAGG - Intronic
1031053492 7:116969411-116969433 TGGGATTTTGAGTTTTTGGGAGG + Intronic
1031866710 7:127044897-127044919 TGTCATTTTTAAATTTTGGGTGG - Intronic
1032244572 7:130198620-130198642 TTTCATTTTTGTTTTTTGGGGGG - Intronic
1032379471 7:131461986-131462008 TGCCATTTTGTTTCCTTGAGTGG - Intronic
1032774842 7:135101567-135101589 TGTCTTTTTATTTTCTTGGCGGG - Intronic
1033594205 7:142843361-142843383 TTTCATTTTGTTTTATTTGGAGG - Intergenic
1034093464 7:148385120-148385142 TGTCATTGTGATTCCTTGCCAGG + Intronic
1034853375 7:154517048-154517070 TGTCATTCTGCTTTCATGGGAGG - Intronic
1035827125 8:2656588-2656610 TTTAATTTTTATTTTTTGGGGGG + Intergenic
1036956019 8:13189446-13189468 TTTCTTTTTGTTTGCTTGGGTGG - Intronic
1037443696 8:18943535-18943557 TGTCCTTTGGATGTCTTGTGGGG - Intronic
1037513294 8:19605057-19605079 TGTCATTATGGTTTCTTATGAGG - Intronic
1038834800 8:31107435-31107457 GATCATTTTCATTTCTTGGGAGG + Intronic
1039823068 8:41150931-41150953 TGTCTTGTTGTTCTCTTGGGAGG - Intergenic
1040377318 8:46838939-46838961 AGTCTTTTTGATTTATTTGGAGG + Intergenic
1041282530 8:56225664-56225686 TGTCATTTTGGATTTTTGAGGGG - Intergenic
1041972310 8:63757872-63757894 TGTTATTTTTATTTCTTGTGGGG + Intergenic
1043700939 8:83288851-83288873 TGTCATTTTGGTTTTTTACGGGG + Intergenic
1043759738 8:84053018-84053040 TGTCATCTTGTATTCTTGTGGGG - Intergenic
1046562134 8:115851472-115851494 TGTCATTTTGTTTGGTTGGTTGG + Intergenic
1046668186 8:117028158-117028180 TGACATTGTGATTTCCTTGGAGG + Intronic
1048586813 8:135781810-135781832 TGTCATGTTGATTTCTGTGATGG - Intergenic
1049930521 9:451698-451720 GGAAATTTTGATTTCTTAGGAGG - Intronic
1051295611 9:15592339-15592361 TGTTTTTTTGCTTTTTTGGGGGG - Intronic
1052409565 9:28105823-28105845 GGTCAATTTGGTTTCTTGTGAGG - Intronic
1052906843 9:33842656-33842678 TGTGATATTTATTGCTTGGGAGG + Intronic
1057854238 9:98590349-98590371 TGTCACTCTGAATTCTTGGCCGG + Intronic
1057864603 9:98669202-98669224 TGTCATTTTGTTTGCTTCTGTGG + Intronic
1057937244 9:99251076-99251098 TTTCATTTTTATTTCTTGCATGG + Intergenic
1060091049 9:120743922-120743944 TCTCCCTTTGCTTTCTTGGGAGG + Intergenic
1060318042 9:122531230-122531252 TGTCATTTAGAATTATTGGAAGG + Intergenic
1060684949 9:125601321-125601343 TGTCATATTCATTTCTTGCAGGG + Intronic
1062079312 9:134612900-134612922 TCTCATTTTCATTTCTTTGTGGG - Intergenic
1062644832 9:137542516-137542538 TTTGATTTTAATTTCTTTGGGGG - Intronic
1062751507 9:138257678-138257700 TGTCATTATTCTTTCTTGGTGGG - Intergenic
1185687061 X:1938006-1938028 TGCCATTTTTCTTTCTTGGGAGG + Intergenic
1185838976 X:3370942-3370964 TGTCATTTTGTTTTGTTTTGTGG + Intergenic
1186638913 X:11434318-11434340 TTTCTCTTTGTTTTCTTGGGTGG - Intronic
1187304037 X:18078885-18078907 TGACTTTTTTATTACTTGGGGGG + Intergenic
1188423519 X:30017876-30017898 CTTCATTGTGTTTTCTTGGGTGG + Intergenic
1188630038 X:32344718-32344740 TGTCATGTAGATTTCTTTAGAGG + Intronic
1188692141 X:33142614-33142636 TGTCACTTTCATTTATTCGGGGG - Intronic
1188739250 X:33757098-33757120 TGTCATCTTGATTTCTTTTTTGG + Intergenic
1190632878 X:52405640-52405662 TGTCATTTTGGGTTTTTTGGAGG + Intergenic
1192404515 X:70870900-70870922 GGTGATTCTGATTTTTTGGGGGG + Intronic
1192891338 X:75394125-75394147 TGTCAACTTGATTGCTTGAGTGG - Intronic
1193023097 X:76813774-76813796 TGTCATTTTGAGATAGTGGGAGG - Intergenic
1193536677 X:82725626-82725648 TTTCATTTTGATTTTCTGTGTGG - Intergenic
1193872666 X:86820871-86820893 TGGCATCTTAACTTCTTGGGAGG - Intronic
1194806049 X:98329394-98329416 TTTCATCTTGATTCCTTGTGTGG - Intergenic
1194947419 X:100085533-100085555 TGTAATTTTGTTTTTTTTGGGGG - Intergenic
1196029220 X:111077019-111077041 TGTTTTCTTGATTTTTTGGGGGG - Intronic
1196361050 X:114859109-114859131 TGTCATTTTACTTTCTTTAGTGG + Intronic
1196702578 X:118687611-118687633 TTTTATTTTTATTTTTTGGGGGG + Intergenic
1196899740 X:120371004-120371026 TTTCATTTTGATTGCCTGGGGGG + Intronic
1197431176 X:126366856-126366878 TGTCATTGTGATTTCAGTGGGGG + Intergenic
1198859988 X:141058495-141058517 TGTCATTTTTTTTTTTTGGGGGG - Intergenic
1198902705 X:141528895-141528917 TGTCATTTTTTTTTTTTGGGGGG + Intergenic
1198992428 X:142530189-142530211 TTTCATATTGATTTCATGGAGGG + Intergenic
1199734647 X:150674034-150674056 TATCCTTTTGCTTTCTTGGAGGG + Intergenic
1199867712 X:151868813-151868835 GGTCCTTTTGATTTATTAGGTGG + Intergenic
1200724008 Y:6643397-6643419 TGGGATTATGAGTTCTTGGGAGG + Intergenic
1201521283 Y:14876561-14876583 TTTTTTTTTTATTTCTTGGGAGG - Intergenic
1202075814 Y:21037177-21037199 TGTCATTTTGGTGTCATGAGGGG + Intergenic