ID: 1153765370

View in Genome Browser
Species Human (GRCh38)
Location 18:8369556-8369578
Sequence AGGAAGAGCGCAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 3, 2: 35, 3: 131, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153765370 Original CRISPR AGGAAGAGCGCAGTGACTGT GGG Intronic
900688467 1:3964827-3964849 AGGAAGAGCGGCCTGACTCTGGG + Intergenic
904128815 1:28260498-28260520 AGGGAGAGCGCAGGGGCTCTGGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908010194 1:59768671-59768693 AGTAAGAGCTCAGTAACGGTTGG - Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
911655021 1:100434333-100434355 AGGAAGAGCCCAGTGGCTACTGG + Intronic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913561244 1:120022532-120022554 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
913636883 1:120771070-120771092 AAGAAGAGGGCAGTGAAGGTGGG + Intergenic
914281830 1:146181942-146181964 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
914542874 1:148632880-148632902 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
914623762 1:149438363-149438385 AAGAAGAGGGCAGTGAAGGTGGG + Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915798927 1:158767744-158767766 AGAAATAGAGCAGTGGCTGTGGG - Intergenic
916744401 1:167673484-167673506 AGGAAGCTCACAGTGAGTGTTGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917720791 1:177784767-177784789 AGGAAGAGGGCAGCTACTGCAGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919752004 1:201043541-201043563 AGGAGAAGAGCAGTGACTGGGGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921678670 1:218006237-218006259 AGGAAGAGTAGAGTGACTGAGGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923538211 1:234869352-234869374 TGGAAGAGAGCAGTGCCTGGAGG - Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1062961004 10:1573645-1573667 AGGAAGAGCTCAGTGTCCTTGGG + Intronic
1063584022 10:7334705-7334727 AGGAAGAGCGCTGGGACACTGGG - Intronic
1065374462 10:25024090-25024112 AGAAAGAGCACAGATACTGTTGG + Exonic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1066290234 10:34007811-34007833 GGGAAGAGAGCAGTTACTCTGGG - Intergenic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067229162 10:44395003-44395025 AGGAGGGAGGCAGTGACTGTTGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069631012 10:69897074-69897096 GGGAAGAGCACAGTGACAGAAGG + Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072221958 10:93334263-93334285 AGGAAAAGCGGAATCACTGTTGG - Intronic
1072897203 10:99377106-99377128 ACCGAGAGCGCAGTGACTTTGGG + Exonic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076392241 10:130111484-130111506 GGGAAAAGCGCAGCCACTGTCGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077888750 11:6404090-6404112 AGGAAGGGAGCAATGAATGTTGG + Intronic
1078855027 11:15200352-15200374 AGGAATAGCATGGTGACTGTTGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079443280 11:20536259-20536281 AGCCAGAGTGCCGTGACTGTGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079950072 11:26790917-26790939 AGGAAGAGGGCGTTGACAGTAGG + Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1083690109 11:64402706-64402728 AGGATGAACCCAGTGACTGCTGG + Intergenic
1083713000 11:64560166-64560188 AGGAAGAGCCAGGTGAGTGTGGG - Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086439232 11:86811912-86811934 AGGAAGCCCTCAGTGAGTGTTGG - Intronic
1087874549 11:103339967-103339989 AGCAAGAGTGAAGTGAGTGTGGG - Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088742590 11:112779200-112779222 AGGAAGAGCTCAGGGTCTGAAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089682859 11:120129159-120129181 AGGAAGAGGACACAGACTGTTGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095372231 12:41482418-41482440 AGGAAGAGGGAAATAACTGTTGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097508517 12:60506933-60506955 AGGAAGAACGCAGCGGCTGGGGG + Intergenic
1097883512 12:64706955-64706977 AGGAAGGGAGAAGTGACTGATGG + Intergenic
1099042889 12:77677703-77677725 AGCAAGCGTGCAGTGAATGTTGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1103996206 12:124831805-124831827 AGGAAGATCGCAGTGACGAAGGG - Intronic
1105783573 13:23725537-23725559 AGCATGAGCCCAGTGCCTGTAGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106475727 13:30096508-30096530 AGGAAGAGCTCAGAGCCTCTGGG + Intergenic
1106906402 13:34413996-34414018 AGGAAGTGGTCAGTAACTGTTGG + Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108181735 13:47846728-47846750 AGTAAGAGCTCAGTAAATGTTGG - Intergenic
1108623290 13:52204540-52204562 CAGAAGAGAGCAGTGAGTGTTGG - Intergenic
1108663439 13:52606497-52606519 CAGAAGAGAGCAGTGAGTGTTGG + Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1112969842 13:105247366-105247388 TGGAAGAGACCAGTGAATGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113767579 13:112890714-112890736 AGGAAGGACGCAGTGACCATGGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115879468 14:37899025-37899047 GGGAAGAGCTGAGTGACTGATGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116658127 14:47675645-47675667 AGGACGCGCGCAGTGCCGGTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119850669 14:77864377-77864399 AGGCAGAGAGCAGGCACTGTAGG + Intronic
1122151592 14:99728845-99728867 AGGCAGAGGGCATGGACTGTGGG - Intergenic
1123164662 14:106314888-106314910 AGGCAGAGGGCAGTGTCTGAGGG + Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1128117337 15:65118157-65118179 AGGAAGATGGCAGTGGCTGTAGG - Exonic
1128702326 15:69813517-69813539 GGGACGAGAGCAGTGACTTTGGG + Intergenic
1131264674 15:90908969-90908991 AGTACTAGCTCAGTGACTGTGGG - Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1135407090 16:22206430-22206452 AGGAAGGGCGCAGGGGCCGTTGG - Exonic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1136292753 16:29285635-29285657 AGAAAGAGCGCGGTGCCTGGGGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1141951017 16:87339435-87339457 AAGATGAACGAAGTGACTGTGGG + Intronic
1142098640 16:88259639-88259661 AGAAAGAGCGCGGTGCCTGGGGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146554587 17:33812825-33812847 AGGAGGAGCACAGTGGCTTTGGG - Intronic
1147734337 17:42625463-42625485 AGGAATAGAGCAGTCACTATGGG - Intergenic
1148572794 17:48683852-48683874 AGAAAGAGGGAAGAGACTGTGGG + Intergenic
1148866086 17:50629402-50629424 TGGAAGAGGGCAGTGCCTGGAGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149564136 17:57629602-57629624 AGGAAGAGGGCTGTTACTGGGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151843220 17:76632460-76632482 AGGAATGGCGCAGTGACTCCTGG + Intronic
1152202515 17:78955321-78955343 AGCAAGATCCCAGTGACTGAGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156177687 18:34565996-34566018 AGCAAGCACTCAGTGACTGTGGG + Intronic
1156379823 18:36547689-36547711 AGGAACGTCGCAGTGTCTGTGGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160327609 18:77965518-77965540 AGGAAGAGAGCACTCACTGGAGG - Intergenic
1161078920 19:2300766-2300788 AGGAGGAGCGCGTTGAATGTTGG - Intronic
1161665389 19:5572936-5572958 AGGAAAAGCTCGGTGGCTGTGGG + Intergenic
1161791346 19:6361989-6362011 AGGAGGGGCGCAGGGAGTGTCGG - Intronic
1162749241 19:12818281-12818303 AAGAAGAGGGCAGTGAGAGTAGG + Intronic
1165698483 19:37919324-37919346 AGTAAGAGCTCAGTGAATGCTGG - Intronic
1166571379 19:43799036-43799058 AGGAAGAACGCTGAGACTGGAGG - Intronic
1167819685 19:51915903-51915925 AGTATGACTGCAGTGACTGTGGG - Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925156934 2:1656200-1656222 AGAAAGAGGGCAGTAACTTTAGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926702406 2:15812189-15812211 TACAAGAGCGCAGTGAGTGTGGG - Intergenic
927720480 2:25378919-25378941 AGGAAGTGGGCAGTGGCTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928693320 2:33823443-33823465 AGTAAGTGCTCAGTGAGTGTAGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
928767855 2:34670003-34670025 AGAAAGAGTGTAGTGACTCTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929493595 2:42419857-42419879 AGCAAGAGAGCAGAGACTGCCGG + Intronic
929589781 2:43137428-43137450 AGGAGGAGAGCAGTGGCTGCAGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
933783573 2:85819569-85819591 AGCAAGAACCCAATGACTGTTGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936125051 2:109781871-109781893 AGGAAAACCTCAGTGCCTGTAGG + Intergenic
936219642 2:110589597-110589619 AGGAAAACCTCAGTGCCTGTAGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938291759 2:130154395-130154417 AGGAAGCTCCCAGTGAATGTGGG + Exonic
938464791 2:131518568-131518590 AGGAAGCTCCCAGTGAATGTGGG - Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939563201 2:143755581-143755603 TGGAAGAGCGCAGGAACTGAAGG - Intronic
939708027 2:145479185-145479207 AGGAAGACTGCAGTGACTAAGGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940811844 2:158252650-158252672 AAGAAGAGAGCAGTATCTGTTGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941640395 2:167981821-167981843 AGGATGATGGCAGTGGCTGTGGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942632997 2:177972279-177972301 AGGAAGAGAACAGTGACAGAAGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943785525 2:191874027-191874049 AGGTAGAGCTCACTCACTGTTGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945128004 2:206534898-206534920 AGGAAGAGCGGCTTGACTGCTGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
946746391 2:222850050-222850072 ATCAAGAGGGCAGAGACTGTTGG + Intergenic
947126818 2:226877849-226877871 GTGAAGAGTGCAGTGACTATTGG + Intronic
947430119 2:230020758-230020780 AGGAAGAGAGCACTGAGTTTGGG - Intergenic
947436067 2:230073411-230073433 AGGCAGAGGGAAGTGTCTGTAGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947691969 2:232146762-232146784 AGGAAGACAGAAGTGAATGTTGG + Intronic
948526822 2:238575943-238575965 GGGAATAGCGCAGTGGCTGAAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169833453 20:9851673-9851695 AGGAAGTGCTCAGTAAATGTTGG - Intergenic
1169932976 20:10853835-10853857 AGCAAGCGTGGAGTGACTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172838890 20:37890201-37890223 AGGAACAGCGCAGTGAATGTGGG + Intergenic
1173142440 20:40495901-40495923 AGAAGGAGCCCAGTGCCTGTTGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174212304 20:48889787-48889809 AAGAAGAAGGCAATGACTGTTGG - Intergenic
1174456064 20:50649598-50649620 AGGAAGGGCCCAGTCCCTGTGGG - Intronic
1174690932 20:52503813-52503835 AAGAAGAGTGTGGTGACTGTGGG + Intergenic
1175418539 20:58817047-58817069 AGCAAGTGCGCAGTGTCTGACGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1179896824 21:44367688-44367710 AGGAAGAGCAGGGTGACTCTAGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180595993 22:16973774-16973796 AGGAAGAGCACAGGGTCTGCTGG - Intronic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1183607248 22:38872857-38872879 AGGAAGGCCGGAGTGACCGTGGG + Intergenic
950620639 3:14202667-14202689 AGGAAAAGAGCAGGGACAGTTGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952247687 3:31613070-31613092 AGTAAGAGCTTAGTGAGTGTAGG + Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
954086025 3:48244751-48244773 AGTAATAGTGCAGTTACTGTGGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
962587001 3:136851798-136851820 AGGAAGAGCAATGTGACAGTGGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963268648 3:143264579-143264601 AGGAAGAGGGCTTTGCCTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964052482 3:152412765-152412787 AGGAAGACCACAGTTAGTGTTGG + Intronic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964475271 3:157092271-157092293 AGGAAGAGCCCAGTGTTGGTCGG + Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966304879 3:178520425-178520447 ACTAAGAGAGTAGTGACTGTGGG + Intronic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966539802 3:181076645-181076667 AGGAAGAGAACTGTGTCTGTAGG + Intergenic
967459845 3:189732965-189732987 AGGAAGAGAGCACTGAGGGTTGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
968393691 4:213560-213582 AGGAAGAGCGCTGAGCTTGTGGG + Intergenic
968557651 4:1255676-1255698 AGGAGGAGGGCAGTTACTGGCGG - Intergenic
971750426 4:30640063-30640085 AGAAAGTGCCCATTGACTGTAGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972686735 4:41360103-41360125 AGTAGGTGCACAGTGACTGTTGG + Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975673400 4:76803815-76803837 GGGAGGAGCGCAGTGAGAGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978387864 4:108193797-108193819 AGTAAGAATGAAGTGACTGTGGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982863296 4:160481563-160481585 AGGAAGACGGCAGTGAAAGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985420122 4:189776898-189776920 AGGAAGATGGCTGTGACTGCAGG - Intergenic
985530517 5:431235-431257 AGGAGGAGCGCTGTGACCTTCGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
988930201 5:36029672-36029694 AGGATGAACACAGTGACTGAAGG + Intergenic
989135819 5:38153675-38153697 AGGAAGAGAGAAATGACTGGTGG + Intergenic
989510432 5:42280612-42280634 AGGAAAAGAGCAGGGGCTGTTGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990170854 5:53048130-53048152 AGGAGGAGTGCTGAGACTGTTGG - Intronic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995195502 5:109362644-109362666 AGGAAGAGGTCACTGACTGGAGG + Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997054417 5:130424181-130424203 GGGAAGAACGGAGTGACAGTTGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999145293 5:149389020-149389042 AGGAAGAACTCAGTAAATGTCGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999846491 5:155486674-155486696 AGTAAGAGCTCAATGAATGTTGG + Intergenic
1000966616 5:167665174-167665196 TGGACAAGGGCAGTGACTGTAGG + Intronic
1001125321 5:169013794-169013816 AGGAAGAGGTAAGTAACTGTAGG - Intronic
1002306404 5:178286402-178286424 AGAAGGGGCGCTGTGACTGTCGG - Intronic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1003176542 6:3756472-3756494 AGGAGGTGAGCAGTGAGTGTGGG + Intergenic
1006274848 6:32995285-32995307 AGGAAGAGCCTAGTAACTTTGGG - Intergenic
1006882805 6:37354394-37354416 AAGAGGAGCGAAGTGTCTGTGGG + Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012050844 6:94342358-94342380 AGGAAGAGCGACGTGGATGTTGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016851153 6:148620288-148620310 TGGAAGAGGGCACTGACTTTTGG + Intergenic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1018735448 6:166684294-166684316 AGGAAAAGGGCAGTAACTTTTGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022840660 7:34161025-34161047 AGGAAGAGGGCAGTTACAGAGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027190566 7:75993762-75993784 GGGAAGAGGGCGGTGGCTGTGGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029983805 7:104903111-104903133 GGGAAGGGAGCAGTGAGTGTTGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031288458 7:119901538-119901560 AGGAAGTGAGCAATGCCTGTGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033156696 7:138962918-138962940 ACAAAGAGGGCAGTAACTGTTGG - Intronic
1033229229 7:139583696-139583718 AGAAAGTGCCCAGTGACTGCAGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034462098 7:151203669-151203691 AGGAAGAGAGGAGTGGCTCTTGG - Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1037892088 8:22628851-22628873 AGAAAGAGCTCCGTGGCTGTGGG - Intronic
1038559046 8:28553679-28553701 TGGAAGATCACAATGACTGTTGG - Intronic
1040295524 8:46147012-46147034 AGCAAGACCGCAGGGAATGTTGG - Intergenic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043432033 8:80204581-80204603 AGGAAGAGCTCAAAGACTGAAGG + Intronic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045168070 8:99629512-99629534 GGGAAGAGAGCAGTTATTGTGGG + Intronic
1045536502 8:103033837-103033859 AGGAAGTGCCCAGTAAGTGTTGG + Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045645496 8:104293291-104293313 AGGAAGGTGGCAGTGCCTGTAGG - Intergenic
1046510797 8:115199845-115199867 AGGAAGAGCTAGATGACTGTCGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048032862 8:130649565-130649587 AGGAAGAGGGGAGTGAGGGTGGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049353511 8:142176720-142176742 TGGAAGACCACAGGGACTGTGGG - Intergenic
1049379324 8:142304208-142304230 AGGAAGTGAGCAGTGCCTGGCGG + Intronic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060360511 9:122951950-122951972 CGGCACAGAGCAGTGACTGTAGG + Intronic
1060909952 9:127341612-127341634 AGGAAGACAGCATTCACTGTAGG + Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061749737 9:132769484-132769506 AGGAGGAGCGCAGTCACTATGGG + Intronic
1062285226 9:135769870-135769892 AGGAAGTGAGCAGGTACTGTGGG + Intronic
1203698121 Un_GL000214v1:115477-115499 AGGCCCAGCGCAGTGACTGATGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186415197 X:9377236-9377258 AGGTAGACCCCAGTGTCTGTTGG + Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187441835 X:19327839-19327861 AGGAGGAGCCCACTGCCTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187713419 X:22076990-22077012 AGGAAGAAGCCAGTGCCTGTGGG + Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189357411 X:40321681-40321703 AGGAAAAGCTCAGTCTCTGTGGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194329120 X:92559648-92559670 AGGAATATTGCAGTGACTGGGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195618738 X:106932835-106932857 AGTAAGAGTTCAGTGAGTGTGGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197898457 X:131342361-131342383 AGGAAGAGGGCAGAGAAGGTGGG + Intronic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1197971883 X:132122966-132122988 AGGAAAATGGCAGTGACTGGAGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199766184 X:150943199-150943221 AGGACGGGCGCAGTGAGAGTTGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200134673 X:153869113-153869135 AGGCAGAGGGCAGTGTCTGAAGG - Intronic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200179923 X:154143997-154144019 AGGAAGGTGGCGGTGACTGTGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201179404 Y:11331812-11331834 ATGAAGAAGGCAGTGCCTGTGGG - Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic