ID: 1153766329

View in Genome Browser
Species Human (GRCh38)
Location 18:8378494-8378516
Sequence CCAAGGAACCTTGTGATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153766329_1153766334 3 Left 1153766329 18:8378494-8378516 CCTTGAATCACAAGGTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1153766334 18:8378520-8378542 CCATAGCACTGTTCGTATTCAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1153766329_1153766335 4 Left 1153766329 18:8378494-8378516 CCTTGAATCACAAGGTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1153766335 18:8378521-8378543 CATAGCACTGTTCGTATTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1153766329_1153766337 9 Left 1153766329 18:8378494-8378516 CCTTGAATCACAAGGTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1153766337 18:8378526-8378548 CACTGTTCGTATTCAGGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 76
1153766329_1153766336 8 Left 1153766329 18:8378494-8378516 CCTTGAATCACAAGGTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1153766336 18:8378525-8378547 GCACTGTTCGTATTCAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 72
1153766329_1153766338 30 Left 1153766329 18:8378494-8378516 CCTTGAATCACAAGGTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1153766338 18:8378547-8378569 GGTAACCCAGAGCTCTACCCAGG 0: 1
1: 0
2: 1
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153766329 Original CRISPR CCAAGGAACCTTGTGATTCA AGG (reversed) Intronic
903658437 1:24962852-24962874 CAAAGGAACCTTGGGAGACAGGG - Intronic
904067036 1:27761091-27761113 CCAATAAACCTTTTGCTTCAGGG + Intronic
904259373 1:29279698-29279720 CCATGGAACCCTGGGATTCTGGG - Intronic
905256803 1:36689986-36690008 ACTTGGAACCTTGTGTTTCAAGG - Intergenic
905822808 1:41006952-41006974 CCCAGGCACCTTCTGATTCCAGG - Intronic
912873866 1:113335845-113335867 ACAAAAAAACTTGTGATTCATGG - Intergenic
917787403 1:178473373-178473395 GAAAGGAACCTTGTCTTTCAGGG + Exonic
918930114 1:190844000-190844022 CCAAGGAATCTTATTCTTCATGG + Intergenic
921525522 1:216211927-216211949 TCAAAGAACCTTGCAATTCATGG + Intronic
921592409 1:217020101-217020123 ACCAGGACCTTTGTGATTCAGGG - Intronic
922167520 1:223128402-223128424 CCAAGGCCCTTTGTGATTGAGGG - Intronic
924495586 1:244585546-244585568 GGAAGGAACCTTGTGGTTGAAGG - Intronic
1062973292 10:1664985-1665007 CCAGGGACCCATGAGATTCAAGG + Intronic
1066481355 10:35798646-35798668 CTCAGGAAGCTTGTGATTCCTGG + Intergenic
1075440455 10:122475900-122475922 CCAAGGAAACTTGTCAGCCACGG - Intronic
1075735305 10:124661197-124661219 CCCTGGAACCTCCTGATTCAGGG - Intronic
1078130516 11:8610461-8610483 CCAAGGGAGTTTGTGTTTCAAGG - Intergenic
1079952242 11:26819627-26819649 CCAAGGATCCCTGTGAGGCAGGG + Intergenic
1080899225 11:36472076-36472098 CTAAGGAACCTTCCAATTCATGG + Intergenic
1081728517 11:45351540-45351562 ACTAGGAACCTTGTGATCTAAGG - Intergenic
1083064646 11:59912281-59912303 CCAAGAAGGCTTGAGATTCATGG + Intergenic
1089659542 11:119977111-119977133 TGAAGGAGCCTTGTGACTCAGGG + Intergenic
1093625608 12:21343682-21343704 CCAAAGAACATTCTGATTAAGGG + Intronic
1095949005 12:47771562-47771584 CTAAGGACCCCTGTGATTGAGGG - Intronic
1096393325 12:51246707-51246729 CCAAGGGACCTTCTGGATCAAGG - Intronic
1098297163 12:69015604-69015626 CCAAGGCATCTTGTCAGTCACGG - Intergenic
1105314117 13:19242047-19242069 CCAAGGATCCCTGTGAGACATGG - Intergenic
1106121108 13:26860788-26860810 GGAAGGAACCTTGGGCTTCAGGG + Intergenic
1107689451 13:42937820-42937842 TCAAGAACACTTGTGATTCATGG - Intronic
1109154821 13:58894281-58894303 CCTGGGAAACTTGTGATTAAGGG - Intergenic
1109554226 13:63950337-63950359 CCAAGAAACCCTGGCATTCACGG - Intergenic
1111407956 13:87834698-87834720 CAAAGGAATATAGTGATTCAAGG + Intergenic
1113508512 13:110832845-110832867 CCAAGGAACCCTGAGCCTCACGG + Intergenic
1115126380 14:29999369-29999391 CCAAGGAAGCCTGGGATACACGG + Intronic
1115645572 14:35366625-35366647 CCAAGGAACCATGTGGGGCAAGG - Intergenic
1116073364 14:40078237-40078259 CCAAGGAAAGTTGTCATGCATGG + Intergenic
1119164157 14:72478557-72478579 CCACGGGACCTTGTCAATCAAGG + Intronic
1120144245 14:80962137-80962159 CCCAGGAATCTGGTGAGTCAGGG - Intronic
1120677169 14:87433889-87433911 CCAAAGAAACCTGTGACTCAAGG + Intergenic
1121036643 14:90710109-90710131 CTAAGAACACTTGTGATTCATGG + Intronic
1121222231 14:92294793-92294815 CTGAGGATCCTTGTGAGTCAGGG - Intergenic
1121303649 14:92891426-92891448 CCCAGGAACCTCGTGCTTCTAGG + Intergenic
1125836394 15:42755372-42755394 CCAAGAAACCATGTGGTTCCAGG + Intronic
1126671711 15:51121303-51121325 CCAAGTCACCCTGTGAGTCAGGG - Intergenic
1127003234 15:54534678-54534700 CCAAGGAATCTAATGATACAAGG + Intronic
1128744358 15:70103177-70103199 CCAAGGGTCCTTGGGCTTCAGGG - Intergenic
1129703482 15:77781536-77781558 CTAAGGAGCCTTTAGATTCAGGG - Intronic
1130413162 15:83664383-83664405 CCAAGGAACATTCTGGTGCATGG - Intronic
1131153430 15:90060917-90060939 CTGAGCAACCTGGTGATTCAAGG + Intronic
1132829628 16:1920979-1921001 CCAAGGAACCGTGTGGGTGAAGG + Intergenic
1135508764 16:23062783-23062805 ACAAGGGCCCTTCTGATTCAAGG - Exonic
1137663501 16:50231965-50231987 CAAAGGAAGGTTATGATTCATGG - Intronic
1139393535 16:66621782-66621804 CAAAGGAAGCCTGTGCTTCAGGG + Intronic
1141563750 16:84887339-84887361 CCCAGGCACTTTGTGGTTCAAGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1148348229 17:46918691-46918713 CCAATGACCCTTGTGGTTCAGGG - Intergenic
1151220585 17:72609431-72609453 CAAATGAACCTTGTGAATAAAGG + Intergenic
1153766329 18:8378494-8378516 CCAAGGAACCTTGTGATTCAAGG - Intronic
1155872849 18:31048761-31048783 CCTTGGAACCTTGTGATTCTTGG - Intergenic
1156112208 18:33742386-33742408 CAAAGGAACTTTGTGATCCTAGG - Intronic
1156593913 18:38523895-38523917 CTAAGGAACATTGGAATTCAAGG + Intergenic
1157671707 18:49535363-49535385 CCAAGAAAACTTGGGATTCCTGG - Intergenic
1161802346 19:6423538-6423560 CCATGGAACCGTCTGATTCTGGG - Intronic
1164725789 19:30464844-30464866 CCACAGAACCTTGTGCTTCCTGG - Intronic
1167732529 19:51269164-51269186 CCAATGAATCTTGGCATTCAGGG - Exonic
925479227 2:4251418-4251440 CCAAGGACCCCTGTGAGACAGGG + Intergenic
931084571 2:58815091-58815113 CCAAGGAATGCTGTGATTCGTGG + Intergenic
931753483 2:65351083-65351105 CCAGGGAAGCTGGTGTTTCAAGG - Intronic
931881006 2:66571137-66571159 CCAGAGAACCCTGTGATTAAGGG - Intronic
932892470 2:75609009-75609031 CAAAGGATCCCTGGGATTCATGG + Intergenic
936796295 2:116208674-116208696 CCATGGAACCTTGACATGCAAGG + Intergenic
936857631 2:116979702-116979724 CCAATGACCCTTGTGAATTAAGG - Intergenic
937264601 2:120607957-120607979 CCAGGGAACCTTGTGAGTAAAGG + Intergenic
938472907 2:131582196-131582218 CCAAGGAACCTTGTAACTTAAGG - Intergenic
942467482 2:176223973-176223995 TTAAGGACCCTTGTGATTCTTGG + Intergenic
942761204 2:179400180-179400202 TCAAGCCACGTTGTGATTCAGGG - Intergenic
943069636 2:183124994-183125016 CAAAGGAATCTTGTTATTAATGG + Intronic
944444564 2:199776241-199776263 CCAAAGAACCTTAGGTTTCAGGG + Intronic
1171006344 20:21468888-21468910 CCAAGGAACCTCCAGATTCTCGG - Intergenic
1174693511 20:52533490-52533512 CCATGCAATCTTGTGCTTCAAGG + Intergenic
1177289047 21:19086430-19086452 ACAAGGACACTTGTGATTTAGGG - Intergenic
1178608779 21:34061969-34061991 CCAAGCAGCCTTGTGATTTGAGG + Intergenic
1180861981 22:19088770-19088792 CCAGTGAACATTGTTATTCATGG + Intronic
1182130750 22:27848787-27848809 CCAAGGACCCTTTTGAGTCCTGG - Intergenic
1182866477 22:33608596-33608618 GCAAAGAACCTGGTGAATCATGG + Intronic
1183187979 22:36303334-36303356 CTAAAGAACCCTGTGATTCCAGG - Intronic
950959503 3:17090402-17090424 CCAAGGACCCCGGGGATTCAGGG - Exonic
951211107 3:19975976-19975998 CCAAGCATCTTTGTGATACAAGG - Intronic
951774378 3:26292928-26292950 CCAAGGAACTTTGTGGGTGATGG + Intergenic
952122631 3:30263414-30263436 CCAAGGAACCCTGTGAGATAAGG - Intergenic
954221688 3:49158751-49158773 CCAAACAACCCTGAGATTCAGGG - Intergenic
954851416 3:53604161-53604183 CCCATCAACCTTGTGCTTCATGG - Intronic
955357267 3:58241421-58241443 CCAAGGAAACTGCTGATTCAGGG + Intronic
956917755 3:73891066-73891088 GCAAAGAATCTTGTGATTGAAGG - Intergenic
957969929 3:87369996-87370018 TCAAGGAACCTAGGGATGCAGGG + Intergenic
959394731 3:105823279-105823301 CCAGGGAGCCTTCTGTTTCAGGG - Intronic
960789587 3:121413687-121413709 TGAAGAAACCTTGTGATTAAGGG + Intronic
960974283 3:123159954-123159976 CCAAAGAACTGTGTGAATCATGG + Intronic
961632128 3:128308754-128308776 CCAAGGAGCCTTGTGTTCCCAGG - Intronic
962871594 3:139499662-139499684 CCAGGAAACCCTGTGGTTCAAGG - Intergenic
964563706 3:158025870-158025892 CAAAGGAACTTTGTTATTGAGGG - Intergenic
967196536 3:187031159-187031181 CCAAGGAAGCTTGAGAGTCAAGG + Intronic
968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG + Intergenic
972647607 4:40983902-40983924 ACAAGAAACCTCATGATTCAGGG - Intronic
973070902 4:45856769-45856791 CCAAGGACCCTTGTCAGACAAGG + Intergenic
976803639 4:89021315-89021337 CCAATGAAGCTTGAGCTTCAGGG + Intronic
979476242 4:121160751-121160773 TCAAGAAACCTTGAGTTTCAAGG + Intronic
980523454 4:133960451-133960473 CTAAGGATCCTTGTGATGCCAGG - Intergenic
981077221 4:140603588-140603610 CTAAGGACCCCTGTGAATCAGGG + Intergenic
981507402 4:145517896-145517918 CCCAGGAATCTTGTGAGTCATGG + Intronic
983014948 4:162602084-162602106 ACAAGGACCCTTGTGCTTCCTGG + Intergenic
985779748 5:1864212-1864234 CCCAGGAATGCTGTGATTCACGG + Intergenic
990268827 5:54112581-54112603 CCAATAGAGCTTGTGATTCATGG - Intronic
992340169 5:75814973-75814995 CCAAGGACCCCTGTGAGGCAGGG + Intergenic
992389672 5:76318596-76318618 CCAAGGAAGTTTATGATGCAGGG + Intronic
993126466 5:83842138-83842160 CTAAGGACATTTGTGATTCATGG + Intergenic
993742935 5:91562663-91562685 CCAAGGACCCCTGTGAGACAAGG - Intergenic
994303981 5:98180314-98180336 CCAAGGACCCCTGTGAGGCAGGG - Intergenic
994798164 5:104333379-104333401 CCAAGGAAAGATGTGAGTCATGG - Intergenic
995013242 5:107281219-107281241 CCAAGGAATATTGTCATTTATGG + Intergenic
995330504 5:110940601-110940623 CCATGGATCCTTGTAATCCATGG - Intergenic
995816327 5:116172436-116172458 CAAAGGTAACTTGTAATTCAGGG - Intronic
997765805 5:136501851-136501873 CCAAGGACCCCTGTGAGGCAAGG + Intergenic
998714935 5:144872373-144872395 CAAAGCAAGCTTGTGACTCAGGG - Intergenic
1002691806 5:181055114-181055136 CCCAGGAAGCTTGTGATTTCAGG + Intronic
1002724584 5:181286222-181286244 CCAAGGCACATGGTGCTTCATGG - Intergenic
1002771625 6:294964-294986 CTAATGAACCTTGTGATTTGGGG - Intronic
1003122089 6:3326865-3326887 CCAGAGAAACTTGTGATTAATGG - Intronic
1004484817 6:16056492-16056514 CCAAGGAACTTCATGATGCAAGG + Intergenic
1005164864 6:22908129-22908151 TCTAGGAACTTTGTTATTCAAGG - Intergenic
1005572300 6:27157151-27157173 CCAAGGAACCATGTGTTGCGTGG + Intergenic
1007675542 6:43591041-43591063 CCAGGGAAGCTTGTGACTTAAGG + Intronic
1011100617 6:83716644-83716666 CCAAGGAAACTTCTAACTCAAGG + Intergenic
1011620500 6:89237847-89237869 CCAAGGACCCCTGTGAGACAAGG + Intergenic
1011817899 6:91213947-91213969 CCAAGGACCCCTGTGAGACAAGG + Intergenic
1017215500 6:151901546-151901568 CCAAGGACCCCTGTGAGACAAGG + Intronic
1022531045 7:31067087-31067109 CTCAGGGACCTTGTGAGTCAGGG + Intronic
1022800718 7:33774823-33774845 CCAAGGAACCATAGGATTCCCGG - Intergenic
1022886330 7:34649611-34649633 CCAAGGAATCCTGTATTTCAAGG - Intergenic
1022894937 7:34740510-34740532 CCAAGGACCCCTGTGAGGCAAGG + Intronic
1024191972 7:47021427-47021449 CAAAGGAGACTTGTGAATCAAGG + Intergenic
1027681942 7:81232873-81232895 CCAAGTAACCTTGTTCTTCCCGG - Intergenic
1031621803 7:123942676-123942698 CCAAGGAACCTTGGGGCTCCTGG + Intronic
1034918503 7:155060163-155060185 CCAAAGAACCTAGTAATCCACGG + Intergenic
1036174206 8:6520962-6520984 CCAAGCATACTTTTGATTCATGG - Intronic
1036620159 8:10419682-10419704 CCAAGTAACCTCCTGATTCTAGG - Intronic
1037890506 8:22621604-22621626 CCAGGGAACCGTGTGCTTCAGGG + Intronic
1049869853 8:144966074-144966096 CCAAGGACCCCTGTGAGACAAGG + Intergenic
1050158682 9:2694801-2694823 CCAGGGAACCTTCTGATTTGTGG - Intergenic
1053172138 9:35895520-35895542 CCAATGAAGCTTATGATTCTGGG + Intergenic
1054451830 9:65407417-65407439 CCAAGGACACTTGTGGTTGAGGG - Intergenic
1057708409 9:97414442-97414464 CCAAGGAAAGTTGAGAATCATGG + Intronic
1058710336 9:107673496-107673518 CAAACAAACCTTGAGATTCAAGG + Intergenic
1061421466 9:130474989-130475011 CCAAGGTACGATGTGACTCAGGG - Intronic
1186419853 X:9416830-9416852 TCAAGGAAACTTGTTTTTCAAGG - Intergenic
1188464372 X:30462656-30462678 TGAAGGAAGCTTGTGATGCATGG - Intergenic
1194932241 X:99901815-99901837 CCAAGGACCCCTGTGAGGCAGGG + Intergenic
1197874238 X:131086860-131086882 CCAAATAACTTTGAGATTCAGGG + Intronic
1201346032 Y:12985644-12985666 CCAAGGAACTTGGTGTTGCATGG - Intergenic