ID: 1153784532

View in Genome Browser
Species Human (GRCh38)
Location 18:8522932-8522954
Sequence CCGTGCCACAGTGAGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153784532_1153784541 16 Left 1153784532 18:8522932-8522954 CCCACCTACTCACTGTGGCACGG No data
Right 1153784541 18:8522971-8522993 CTACAGCAATCCTTGTGTTGTGG No data
1153784532_1153784542 20 Left 1153784532 18:8522932-8522954 CCCACCTACTCACTGTGGCACGG No data
Right 1153784542 18:8522975-8522997 AGCAATCCTTGTGTTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153784532 Original CRISPR CCGTGCCACAGTGAGTAGGT GGG (reversed) Intergenic
No off target data available for this crispr