ID: 1153784819

View in Genome Browser
Species Human (GRCh38)
Location 18:8525306-8525328
Sequence AAACCCTGCTTCCCAAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153784816_1153784819 -5 Left 1153784816 18:8525288-8525310 CCACTTCTTCCACAGTGAAAACC No data
Right 1153784819 18:8525306-8525328 AAACCCTGCTTCCCAAAACAGGG No data
1153784815_1153784819 12 Left 1153784815 18:8525271-8525293 CCACAGCTTCTCTCATTCCACTT No data
Right 1153784819 18:8525306-8525328 AAACCCTGCTTCCCAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153784819 Original CRISPR AAACCCTGCTTCCCAAAACA GGG Intergenic
No off target data available for this crispr