ID: 1153785309

View in Genome Browser
Species Human (GRCh38)
Location 18:8528987-8529009
Sequence TGGGCGGGACCTCAAAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153785305_1153785309 -9 Left 1153785305 18:8528973-8528995 CCATTCCTCCTCATTGGGCGGGA No data
Right 1153785309 18:8528987-8529009 TGGGCGGGACCTCAAAACCAGGG No data
1153785296_1153785309 23 Left 1153785296 18:8528941-8528963 CCCAGACTGCTGCTTTATGCAGG No data
Right 1153785309 18:8528987-8529009 TGGGCGGGACCTCAAAACCAGGG No data
1153785298_1153785309 22 Left 1153785298 18:8528942-8528964 CCAGACTGCTGCTTTATGCAGGC No data
Right 1153785309 18:8528987-8529009 TGGGCGGGACCTCAAAACCAGGG No data
1153785299_1153785309 -2 Left 1153785299 18:8528966-8528988 CCTGATCCCATTCCTCCTCATTG No data
Right 1153785309 18:8528987-8529009 TGGGCGGGACCTCAAAACCAGGG No data
1153785303_1153785309 -8 Left 1153785303 18:8528972-8528994 CCCATTCCTCCTCATTGGGCGGG No data
Right 1153785309 18:8528987-8529009 TGGGCGGGACCTCAAAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153785309 Original CRISPR TGGGCGGGACCTCAAAACCA GGG Intergenic
No off target data available for this crispr