ID: 1153789923

View in Genome Browser
Species Human (GRCh38)
Location 18:8569195-8569217
Sequence TTGGTACTTATTTGGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153789920_1153789923 -2 Left 1153789920 18:8569174-8569196 CCTACTTTCAGTTGTATTTGCTT No data
Right 1153789923 18:8569195-8569217 TTGGTACTTATTTGGAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153789923 Original CRISPR TTGGTACTTATTTGGAATGA TGG Intergenic
No off target data available for this crispr