ID: 1153791903

View in Genome Browser
Species Human (GRCh38)
Location 18:8586533-8586555
Sequence GGTGGTTTCCCCATGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791903_1153791911 12 Left 1153791903 18:8586533-8586555 CCCATGGCCATGGGGAAACCACC No data
Right 1153791911 18:8586568-8586590 AGAAGCATCCCCCCGAGTTAGGG No data
1153791903_1153791918 25 Left 1153791903 18:8586533-8586555 CCCATGGCCATGGGGAAACCACC No data
Right 1153791918 18:8586581-8586603 CGAGTTAGGGAACTTCCAGCGGG No data
1153791903_1153791917 24 Left 1153791903 18:8586533-8586555 CCCATGGCCATGGGGAAACCACC No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791903_1153791910 11 Left 1153791903 18:8586533-8586555 CCCATGGCCATGGGGAAACCACC No data
Right 1153791910 18:8586567-8586589 GAGAAGCATCCCCCCGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791903 Original CRISPR GGTGGTTTCCCCATGGCCAT GGG (reversed) Intergenic