ID: 1153791907

View in Genome Browser
Species Human (GRCh38)
Location 18:8586551-8586573
Sequence GCTTCTCCTGTGGCTCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791907_1153791910 -7 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791910 18:8586567-8586589 GAGAAGCATCCCCCCGAGTTAGG No data
1153791907_1153791921 26 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791921 18:8586600-8586622 CGGGAAGTGCCCACCTTCGTGGG No data
1153791907_1153791922 29 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791922 18:8586603-8586625 GAAGTGCCCACCTTCGTGGGTGG No data
1153791907_1153791920 25 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791907_1153791911 -6 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791911 18:8586568-8586590 AGAAGCATCCCCCCGAGTTAGGG No data
1153791907_1153791917 6 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791907_1153791918 7 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791918 18:8586581-8586603 CGAGTTAGGGAACTTCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791907 Original CRISPR GCTTCTCCTGTGGCTCACGG TGG (reversed) Intergenic
No off target data available for this crispr