ID: 1153791908

View in Genome Browser
Species Human (GRCh38)
Location 18:8586554-8586576
Sequence GATGCTTCTCCTGTGGCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791908_1153791918 4 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791918 18:8586581-8586603 CGAGTTAGGGAACTTCCAGCGGG No data
1153791908_1153791923 30 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791923 18:8586607-8586629 TGCCCACCTTCGTGGGTGGCTGG No data
1153791908_1153791921 23 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791921 18:8586600-8586622 CGGGAAGTGCCCACCTTCGTGGG No data
1153791908_1153791922 26 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791922 18:8586603-8586625 GAAGTGCCCACCTTCGTGGGTGG No data
1153791908_1153791917 3 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791908_1153791920 22 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791908_1153791910 -10 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791910 18:8586567-8586589 GAGAAGCATCCCCCCGAGTTAGG No data
1153791908_1153791911 -9 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791911 18:8586568-8586590 AGAAGCATCCCCCCGAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791908 Original CRISPR GATGCTTCTCCTGTGGCTCA CGG (reversed) Intergenic
No off target data available for this crispr