ID: 1153791909

View in Genome Browser
Species Human (GRCh38)
Location 18:8586561-8586583
Sequence TCGGGGGGATGCTTCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791909_1153791929 30 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791929 18:8586614-8586636 CTTCGTGGGTGGCTGGAGGAGGG No data
1153791909_1153791926 26 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791926 18:8586610-8586632 CCACCTTCGTGGGTGGCTGGAGG No data
1153791909_1153791923 23 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791923 18:8586607-8586629 TGCCCACCTTCGTGGGTGGCTGG No data
1153791909_1153791921 16 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791921 18:8586600-8586622 CGGGAAGTGCCCACCTTCGTGGG No data
1153791909_1153791922 19 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791922 18:8586603-8586625 GAAGTGCCCACCTTCGTGGGTGG No data
1153791909_1153791918 -3 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791918 18:8586581-8586603 CGAGTTAGGGAACTTCCAGCGGG No data
1153791909_1153791920 15 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791909_1153791928 29 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791909_1153791917 -4 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791909 Original CRISPR TCGGGGGGATGCTTCTCCTG TGG (reversed) Intergenic