ID: 1153791912

View in Genome Browser
Species Human (GRCh38)
Location 18:8586576-8586598
Sequence TGGAAGTTCCCTAACTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791912_1153791922 4 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791922 18:8586603-8586625 GAAGTGCCCACCTTCGTGGGTGG No data
1153791912_1153791930 16 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791930 18:8586615-8586637 TTCGTGGGTGGCTGGAGGAGGGG No data
1153791912_1153791921 1 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791921 18:8586600-8586622 CGGGAAGTGCCCACCTTCGTGGG No data
1153791912_1153791920 0 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791912_1153791926 11 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791926 18:8586610-8586632 CCACCTTCGTGGGTGGCTGGAGG No data
1153791912_1153791929 15 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791929 18:8586614-8586636 CTTCGTGGGTGGCTGGAGGAGGG No data
1153791912_1153791923 8 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791923 18:8586607-8586629 TGCCCACCTTCGTGGGTGGCTGG No data
1153791912_1153791928 14 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791912_1153791931 24 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791912 Original CRISPR TGGAAGTTCCCTAACTCGGG GGG (reversed) Intergenic
No off target data available for this crispr