ID: 1153791913

View in Genome Browser
Species Human (GRCh38)
Location 18:8586577-8586599
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791913_1153791928 13 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791913_1153791921 0 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791921 18:8586600-8586622 CGGGAAGTGCCCACCTTCGTGGG No data
1153791913_1153791931 23 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791913_1153791930 15 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791930 18:8586615-8586637 TTCGTGGGTGGCTGGAGGAGGGG No data
1153791913_1153791923 7 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791923 18:8586607-8586629 TGCCCACCTTCGTGGGTGGCTGG No data
1153791913_1153791929 14 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791929 18:8586614-8586636 CTTCGTGGGTGGCTGGAGGAGGG No data
1153791913_1153791922 3 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791922 18:8586603-8586625 GAAGTGCCCACCTTCGTGGGTGG No data
1153791913_1153791926 10 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791926 18:8586610-8586632 CCACCTTCGTGGGTGGCTGGAGG No data
1153791913_1153791920 -1 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791913 Original CRISPR CTGGAAGTTCCCTAACTCGG GGG (reversed) Intergenic