ID: 1153791917

View in Genome Browser
Species Human (GRCh38)
Location 18:8586580-8586602
Sequence CCGAGTTAGGGAACTTCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791904_1153791917 23 Left 1153791904 18:8586534-8586556 CCATGGCCATGGGGAAACCACCG No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791909_1153791917 -4 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791903_1153791917 24 Left 1153791903 18:8586533-8586555 CCCATGGCCATGGGGAAACCACC No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791908_1153791917 3 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791907_1153791917 6 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
1153791905_1153791917 17 Left 1153791905 18:8586540-8586562 CCATGGGGAAACCACCGTGAGCC No data
Right 1153791917 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791917 Original CRISPR CCGAGTTAGGGAACTTCCAG CGG Intergenic
No off target data available for this crispr