ID: 1153791919

View in Genome Browser
Species Human (GRCh38)
Location 18:8586596-8586618
Sequence CGAAGGTGGGCACTTCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791919_1153791930 -4 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791930 18:8586615-8586637 TTCGTGGGTGGCTGGAGGAGGGG No data
1153791919_1153791933 26 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791933 18:8586645-8586667 GAACCCACACAAACCTCCACGGG No data
1153791919_1153791928 -6 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791919_1153791929 -5 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791929 18:8586614-8586636 CTTCGTGGGTGGCTGGAGGAGGG No data
1153791919_1153791932 25 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791932 18:8586644-8586666 GGAACCCACACAAACCTCCACGG No data
1153791919_1153791931 4 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791919_1153791926 -9 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791926 18:8586610-8586632 CCACCTTCGTGGGTGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791919 Original CRISPR CGAAGGTGGGCACTTCCCGC TGG (reversed) Intergenic