ID: 1153791920

View in Genome Browser
Species Human (GRCh38)
Location 18:8586599-8586621
Sequence GCGGGAAGTGCCCACCTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791915_1153791920 -3 Left 1153791915 18:8586579-8586601 CCCGAGTTAGGGAACTTCCAGCG No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791909_1153791920 15 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791913_1153791920 -1 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791916_1153791920 -4 Left 1153791916 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791907_1153791920 25 Left 1153791907 18:8586551-8586573 CCACCGTGAGCCACAGGAGAAGC No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791912_1153791920 0 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791914_1153791920 -2 Left 1153791914 18:8586578-8586600 CCCCGAGTTAGGGAACTTCCAGC No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data
1153791908_1153791920 22 Left 1153791908 18:8586554-8586576 CCGTGAGCCACAGGAGAAGCATC No data
Right 1153791920 18:8586599-8586621 GCGGGAAGTGCCCACCTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791920 Original CRISPR GCGGGAAGTGCCCACCTTCG TGG Intergenic
No off target data available for this crispr