ID: 1153791924

View in Genome Browser
Species Human (GRCh38)
Location 18:8586609-8586631
Sequence CTCCAGCCACCCACGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791924_1153791937 25 Left 1153791924 18:8586609-8586631 CCCACCTTCGTGGGTGGCTGGAG No data
Right 1153791937 18:8586657-8586679 ACCTCCACGGGAGAAGGCATTGG No data
1153791924_1153791936 19 Left 1153791924 18:8586609-8586631 CCCACCTTCGTGGGTGGCTGGAG No data
Right 1153791936 18:8586651-8586673 ACACAAACCTCCACGGGAGAAGG No data
1153791924_1153791931 -9 Left 1153791924 18:8586609-8586631 CCCACCTTCGTGGGTGGCTGGAG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791924_1153791933 13 Left 1153791924 18:8586609-8586631 CCCACCTTCGTGGGTGGCTGGAG No data
Right 1153791933 18:8586645-8586667 GAACCCACACAAACCTCCACGGG No data
1153791924_1153791932 12 Left 1153791924 18:8586609-8586631 CCCACCTTCGTGGGTGGCTGGAG No data
Right 1153791932 18:8586644-8586666 GGAACCCACACAAACCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791924 Original CRISPR CTCCAGCCACCCACGAAGGT GGG (reversed) Intergenic