ID: 1153791928

View in Genome Browser
Species Human (GRCh38)
Location 18:8586613-8586635
Sequence CCTTCGTGGGTGGCTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791914_1153791928 12 Left 1153791914 18:8586578-8586600 CCCCGAGTTAGGGAACTTCCAGC No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791913_1153791928 13 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791916_1153791928 10 Left 1153791916 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791912_1153791928 14 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791919_1153791928 -6 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791915_1153791928 11 Left 1153791915 18:8586579-8586601 CCCGAGTTAGGGAACTTCCAGCG No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data
1153791909_1153791928 29 Left 1153791909 18:8586561-8586583 CCACAGGAGAAGCATCCCCCCGA No data
Right 1153791928 18:8586613-8586635 CCTTCGTGGGTGGCTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791928 Original CRISPR CCTTCGTGGGTGGCTGGAGG AGG Intergenic
No off target data available for this crispr