ID: 1153791931

View in Genome Browser
Species Human (GRCh38)
Location 18:8586623-8586645
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153791919_1153791931 4 Left 1153791919 18:8586596-8586618 CCAGCGGGAAGTGCCCACCTTCG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791912_1153791931 24 Left 1153791912 18:8586576-8586598 CCCCCCGAGTTAGGGAACTTCCA No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791914_1153791931 22 Left 1153791914 18:8586578-8586600 CCCCGAGTTAGGGAACTTCCAGC No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791924_1153791931 -9 Left 1153791924 18:8586609-8586631 CCCACCTTCGTGGGTGGCTGGAG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791916_1153791931 20 Left 1153791916 18:8586580-8586602 CCGAGTTAGGGAACTTCCAGCGG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791913_1153791931 23 Left 1153791913 18:8586577-8586599 CCCCCGAGTTAGGGAACTTCCAG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791915_1153791931 21 Left 1153791915 18:8586579-8586601 CCCGAGTTAGGGAACTTCCAGCG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data
1153791925_1153791931 -10 Left 1153791925 18:8586610-8586632 CCACCTTCGTGGGTGGCTGGAGG No data
Right 1153791931 18:8586623-8586645 TGGCTGGAGGAGGGGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153791931 Original CRISPR TGGCTGGAGGAGGGGCTCTG AGG Intergenic