ID: 1153794265

View in Genome Browser
Species Human (GRCh38)
Location 18:8608854-8608876
Sequence CGCTCTCTCACAAACACCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153794265_1153794270 15 Left 1153794265 18:8608854-8608876 CCGCTGGTGTTTGTGAGAGAGCG No data
Right 1153794270 18:8608892-8608914 ACGCAGCGCAGGCGGCCCGGCGG No data
1153794265_1153794267 4 Left 1153794265 18:8608854-8608876 CCGCTGGTGTTTGTGAGAGAGCG No data
Right 1153794267 18:8608881-8608903 TGTAGACGCGAACGCAGCGCAGG No data
1153794265_1153794268 7 Left 1153794265 18:8608854-8608876 CCGCTGGTGTTTGTGAGAGAGCG No data
Right 1153794268 18:8608884-8608906 AGACGCGAACGCAGCGCAGGCGG No data
1153794265_1153794271 20 Left 1153794265 18:8608854-8608876 CCGCTGGTGTTTGTGAGAGAGCG No data
Right 1153794271 18:8608897-8608919 GCGCAGGCGGCCCGGCGGCGCGG No data
1153794265_1153794272 27 Left 1153794265 18:8608854-8608876 CCGCTGGTGTTTGTGAGAGAGCG No data
Right 1153794272 18:8608904-8608926 CGGCCCGGCGGCGCGGCCTCAGG No data
1153794265_1153794269 12 Left 1153794265 18:8608854-8608876 CCGCTGGTGTTTGTGAGAGAGCG No data
Right 1153794269 18:8608889-8608911 CGAACGCAGCGCAGGCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153794265 Original CRISPR CGCTCTCTCACAAACACCAG CGG (reversed) Intergenic
No off target data available for this crispr