ID: 1153794697

View in Genome Browser
Species Human (GRCh38)
Location 18:8610639-8610661
Sequence CAGTTTCCATTTCAGATCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153794697_1153794701 13 Left 1153794697 18:8610639-8610661 CCGTGGATCTGAAATGGAAACTG 0: 1
1: 0
2: 2
3: 24
4: 269
Right 1153794701 18:8610675-8610697 TTTAATTAAGTCATGCTTAGAGG 0: 1
1: 0
2: 1
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153794697 Original CRISPR CAGTTTCCATTTCAGATCCA CGG (reversed) Intronic
901562656 1:10085010-10085032 CAGTTTCCAGTTGGAATCCAAGG + Intronic
902417724 1:16251306-16251328 CAGATCCCAATTCAGATCTATGG + Exonic
903156737 1:21449979-21450001 GAATTTCAATTTCAGATACATGG - Intronic
903747609 1:25598725-25598747 CAGTCTCCGTTTCAGATCACAGG - Intergenic
904817986 1:33219990-33220012 CAGTTTCCCCTTCTGAGCCAGGG - Intergenic
905312064 1:37056299-37056321 CAGTTCTCATTTCCCATCCAGGG - Intergenic
905900801 1:41581043-41581065 CAGTTTGCACTTCAGCTCCCTGG - Exonic
905918489 1:41702482-41702504 CAGTTCCCATTTTACATACAGGG - Intronic
906174255 1:43756250-43756272 TAGTTTCCATTTCACATACATGG - Intronic
907590223 1:55659615-55659637 CAGTTAGCATTTCACATGCAAGG - Intergenic
908347245 1:63247231-63247253 CAGTTTCCATTTCTGTACAATGG - Intergenic
909085287 1:71163139-71163161 CCATTTCCATTTCACATGCAAGG - Intergenic
909514173 1:76488710-76488732 CAGGTTCCATTACAGACTCATGG - Intronic
909677129 1:78251124-78251146 AAGTTTCTATTTCAGATTAAAGG - Intergenic
910052463 1:82991655-82991677 TAGTTTCTATTTCTGATACATGG + Intergenic
910254244 1:85231323-85231345 CAGTTTTTATTTTAGATACAGGG + Intergenic
911227366 1:95320878-95320900 GAGTTTCCTTTTCAGATTCCAGG + Intergenic
912125309 1:106530091-106530113 AAATTTCCATTTTAGATTCAGGG - Intergenic
912834119 1:112980384-112980406 CAATTTCCATTTTATATCCAGGG - Intergenic
917326787 1:173841462-173841484 GAGTTTACATTCCAGATCCGGGG + Intronic
917820213 1:178755189-178755211 CAGTTTTTATTTTAGATTCATGG + Intronic
920341084 1:205275567-205275589 CAATTTCCCTTTCAAAGCCAGGG + Intergenic
920574827 1:207051654-207051676 CAGATTCCAGTTCAGTTCCTGGG + Intronic
920803271 1:209208703-209208725 CATTTTCCAAATCAGCTCCAGGG - Intergenic
921163821 1:212491628-212491650 CAGTTCCCATTTCGGATATAAGG - Intergenic
922330406 1:224570175-224570197 CAATTTCTATTTTAGATTCAAGG + Intronic
924367894 1:243315770-243315792 CAGTTTCCTTTTCATTGCCAAGG - Intronic
1064129677 10:12697848-12697870 CTGTGTCCATTTCACAGCCATGG + Intronic
1064595319 10:16938759-16938781 TATTTTCCATTTCATATCTAAGG - Intronic
1066229484 10:33418490-33418512 CACTTCCCATTTCATGTCCAAGG + Intergenic
1067093689 10:43284875-43284897 CAGTTTCCATGTCAGTAACAGGG + Intergenic
1068048109 10:51913228-51913250 CAATTTCTATTTTAGATACAGGG + Intronic
1070516449 10:77212548-77212570 CAGTTTTTATTTTAGATACAGGG - Intronic
1070728892 10:78811435-78811457 CAGCATCCATTGCAGATCCAGGG + Intergenic
1071116529 10:82227888-82227910 CATTTTCCATTTCAGTTCAAGGG + Intronic
1071240564 10:83700480-83700502 CAGTTTCCATTGTATATCAAAGG - Intergenic
1072315096 10:94194604-94194626 CAGATTTGAATTCAGATCCAAGG + Intronic
1075292040 10:121239034-121239056 CAGATTCCATTTCAGACCTAGGG - Intergenic
1076908659 10:133376755-133376777 CACTCTCCATTTCAGAGCAAGGG + Intergenic
1076987856 11:252490-252512 GGATTTCCATTTCAGATCAAGGG + Exonic
1077062632 11:624594-624616 CCCTTTGCATTTCGGATCCAGGG - Exonic
1077777533 11:5288098-5288120 TAGTTTCCATGTCACAGCCAGGG + Intronic
1078402301 11:11038973-11038995 CAGCTTCGATTCCAGATCAAAGG + Intergenic
1080173066 11:29329283-29329305 CAGTTTCCTTCCCAGAACCAGGG - Intergenic
1081519193 11:43864985-43865007 CAGTATGCATTTAAGATTCATGG + Intergenic
1081535449 11:43993022-43993044 CATGTGCCATTTCAGAGCCAAGG - Intergenic
1083729515 11:64645169-64645191 CAGTCTATATTCCAGATCCAGGG - Intronic
1086403100 11:86476779-86476801 CCATTTCCATTTTAGATCCCTGG - Intronic
1086754282 11:90539620-90539642 CAACTTTCATTTTAGATCCAAGG + Intergenic
1088095269 11:106092523-106092545 CAGTTTCAACTTCAAATCCATGG - Intronic
1089701712 11:120248606-120248628 CAGGTCCCTTTTCAGCTCCAAGG + Intronic
1091395230 12:150286-150308 GATTTTCCATTTCAGAGGCAGGG + Intronic
1092947121 12:13466929-13466951 CAGCTTTCATTTCAGTTCCCAGG + Intergenic
1093172967 12:15879578-15879600 CAGTTTCTCATTCAGATCTATGG + Intronic
1093334459 12:17885460-17885482 CACTTTCCATTTGAGATCCGTGG - Intergenic
1095244096 12:39898871-39898893 CATTTTCCATTTTATATACAAGG - Intronic
1095681367 12:44980351-44980373 CAATTTTTATTTCAGATTCAGGG + Intergenic
1095951366 12:47783652-47783674 CAGTTCCCATTCTAGACCCAGGG + Exonic
1096533631 12:52257259-52257281 CATTTTCCCTTTCAGAGTCATGG + Intronic
1096536836 12:52280230-52280252 CTGTCTCTACTTCAGATCCAGGG + Intronic
1097969814 12:65621173-65621195 CAGTTTATATTTTAGATACAGGG - Intergenic
1098738299 12:74136538-74136560 CAGTTTCTATTTTGGATTCAGGG + Intergenic
1099245383 12:80187703-80187725 GACTGTCCCTTTCAGATCCAAGG - Intergenic
1100365261 12:93914710-93914732 CAGCTTTCATTTTAGATTCAGGG - Intergenic
1100807596 12:98303523-98303545 CACTTTCCATCTCATTTCCATGG + Intergenic
1101213182 12:102555092-102555114 CAGTTTACATTTATGCTCCATGG + Intergenic
1102513530 12:113431451-113431473 TAGTTTTAATTTCAGATTCAGGG + Intronic
1103896543 12:124277369-124277391 CAGTGTCCTTTCCAGATCCTGGG + Intronic
1105547177 13:21359408-21359430 CAGTTTCCATTCCAGACTCCTGG + Intergenic
1105570194 13:21595504-21595526 CAGCTTCCATGGCAGCTCCAGGG + Intronic
1106243348 13:27927178-27927200 AAGTTCCCCTTTCTGATCCAAGG - Intergenic
1106680847 13:32005666-32005688 CAGTTTCCCTTTCAAATGCTTGG + Intergenic
1108156137 13:47586470-47586492 CTACTTCCATTTTAGATCCAAGG - Intergenic
1109180747 13:59211713-59211735 CAGTTTCCTTATCATCTCCAGGG + Intergenic
1109652427 13:65346853-65346875 CAGCTTCTATTTTAGATTCAGGG - Intergenic
1110132068 13:72021580-72021602 CAGTTTCCATTGCAGCCACAAGG - Intergenic
1110545187 13:76748079-76748101 CAGCTTTCATTTTAGATACAGGG - Intergenic
1111481654 13:88835411-88835433 CAGTCTCCATTTTAGCTCTATGG - Intergenic
1113187633 13:107707459-107707481 GAATTTCCATTTCAGTTCCAAGG - Intronic
1113352010 13:109538485-109538507 CAGTTGGCTTTTCAGAACCAGGG - Intergenic
1117065398 14:52008782-52008804 CAGTTTCCTTCTCAAATCCCTGG - Exonic
1117307998 14:54495278-54495300 CAGTTTCCTTTTAAAATCGAAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1119122912 14:72096626-72096648 CAGCTGCCATTTAAGAGCCAGGG - Intronic
1119320101 14:73725521-73725543 TAGTTTCCATTTCACAAGCAAGG - Intronic
1119572277 14:75685676-75685698 CAGGTCCCATTGCAGATTCATGG + Intronic
1120496751 14:85247535-85247557 CACTCTCCCTTTCACATCCAGGG + Intergenic
1121449432 14:93998021-93998043 CAGCTTCCTCTTCAGATCCTTGG - Intergenic
1121750166 14:96347255-96347277 CAATTTCCCTGTCAGTTCCATGG - Exonic
1124241234 15:28029643-28029665 CAGTTGTCAGTTCAGATACAGGG + Intronic
1124765251 15:32482855-32482877 CAGTTTCCCTATCTGTTCCATGG + Intergenic
1124891596 15:33738732-33738754 GAGTTTCCATTTCAGAGAGATGG - Intronic
1125562155 15:40643156-40643178 AAGTTTCCAATTCAGTTCAAAGG - Intronic
1125911523 15:43443951-43443973 AGGTTTCTATTTCAGAGCCAGGG - Intronic
1127767123 15:62197205-62197227 GAGTTGCCATTTCAGAGCCTGGG + Intergenic
1127942067 15:63708888-63708910 CAGATTCCATTTCAGATGAAGGG - Intronic
1129134676 15:73536879-73536901 CAATTTTCATTTTAGATTCAGGG + Intronic
1132054929 15:98643716-98643738 CAGTTTCCATTTTGGACCCACGG + Intergenic
1132145939 15:99429964-99429986 CAGCTTCCATTTCAGAGGGAAGG - Intergenic
1134294233 16:12931286-12931308 CAGCTTTCATTTTAGATTCAGGG + Intronic
1134811528 16:17171277-17171299 CAGTTTGGATTTCAGCCCCAAGG + Intronic
1134849502 16:17469420-17469442 GAGTCCCCATTTCAGAGCCAAGG - Intronic
1135640963 16:24119469-24119491 CAGTTCCCATTTCCCATCCTGGG - Intronic
1136703863 16:32169326-32169348 CATTTGCCATTTCATATCCGTGG - Intergenic
1138584491 16:57961091-57961113 CAGCCTCCATTTCTGAGCCAGGG + Intronic
1139578487 16:67857486-67857508 CAGTTTCCATTCCTGATTCTAGG + Intronic
1140258091 16:73354206-73354228 CAGTTTGAATTTCAGATAAATGG - Intergenic
1141295450 16:82763975-82763997 CCCTTTCCTTTTCAAATCCAGGG - Intronic
1141696644 16:85623408-85623430 CAGTTTCCCTGTCAGTACCATGG - Intronic
1203066193 16_KI270728v1_random:1020402-1020424 CATTTGCCATTTCATATCCGTGG + Intergenic
1144226503 17:13153579-13153601 CAGTTTCCAATTGGGATGCAAGG - Intergenic
1144722575 17:17482013-17482035 CTGTTTCCATTTCATATCCATGG - Intronic
1144824693 17:18099202-18099224 CAGGTTCCAGTTCAAATCCTTGG + Intronic
1145969414 17:28947971-28947993 CAGTTTCCACTTTAGATGAAAGG - Intronic
1146503532 17:33384843-33384865 TTGTTTACATTTCATATCCATGG + Intronic
1147374820 17:40017196-40017218 CAGTGCCCATTGCAGAGCCAGGG - Exonic
1148291803 17:46458479-46458501 CAGCTTCCATTCCAGAACCCAGG - Intergenic
1148313993 17:46676184-46676206 CAGCTTCCATTCCAGAACCCAGG - Intronic
1149056330 17:52370947-52370969 CAGTTTTTATTTTAGATACAGGG - Intergenic
1149275868 17:55035086-55035108 AAGTTTGCATTTCAAATCAATGG - Intronic
1150534915 17:66026918-66026940 CAGTTGGCCTTTCATATCCATGG - Intronic
1152382365 17:79948686-79948708 CAGTTGGCATCTCAGAGCCATGG - Intronic
1153794697 18:8610639-8610661 CAGTTTCCATTTCAGATCCACGG - Intronic
1155843177 18:30671135-30671157 CAGTTTCTATTTCAGATGACTGG - Intergenic
1156540589 18:37906029-37906051 AGGTTTCCATTTCATATCCTTGG - Intergenic
1156766085 18:40657160-40657182 CAACTTTCATTTCAGATTCAGGG - Intergenic
1158193498 18:54857958-54857980 TAGTTTCCATTTTAGATCCCAGG + Intronic
1160576364 18:79856507-79856529 CATTTTCCATTTCAGAGAGAGGG + Intergenic
1164401649 19:27906029-27906051 CATTCTCCATTTCTGATCAAGGG + Intergenic
1164447195 19:28328037-28328059 CAATTTTCATTTTAGATTCAGGG + Intergenic
1164539214 19:29109857-29109879 CAGTTACAATTTCAGATGCGGGG - Intergenic
1164582688 19:29444412-29444434 CAATTTTCATTTTAGATGCAAGG + Intergenic
1165545796 19:36534900-36534922 CAGCTTCCATTTCCCTTCCATGG + Intronic
1165800211 19:38544897-38544919 CAGTTCATATTACAGATCCAGGG + Intronic
1166213387 19:41321230-41321252 CAGATTCCATTCAAGAGCCAGGG - Intronic
1166335830 19:42106607-42106629 CAGTTTTTATTTTAGATTCAGGG - Intronic
1166802836 19:45468812-45468834 CCTTTTCCATCTCAGATCTAGGG - Intronic
925783343 2:7404259-7404281 TATTTTCCACTTCAGCTCCAGGG + Intergenic
926208196 2:10848926-10848948 CAGTCTCCATTCAAGATCCCTGG + Intronic
926506025 2:13717105-13717127 CAGTTGGCCTTTCATATCCATGG - Intergenic
927103863 2:19807845-19807867 CAGTTTCCACTGGAGAGCCAGGG + Intergenic
927206256 2:20612913-20612935 CATTTTCCATTCCACAGCCATGG + Intronic
927667705 2:25043554-25043576 ACGTTTGCATTTCTGATCCAGGG + Intronic
928877668 2:36059765-36059787 CAGCTTCCATATCTGATCCTAGG - Intergenic
929228933 2:39539484-39539506 CAGTTTCCTTATCAGAGCAAAGG - Intergenic
930420177 2:51141397-51141419 CACTTTCCATTTAATCTCCAGGG - Intergenic
930864033 2:56105456-56105478 GAGTTTCCATATCACATACAGGG + Intergenic
932503666 2:72208091-72208113 CAGTTTTTATTTTAGATACAGGG + Intronic
933411748 2:81934461-81934483 CATATTGCCTTTCAGATCCATGG - Intergenic
933570895 2:84010387-84010409 CAGCTTTTATTTCAGATTCAGGG - Intergenic
934323061 2:91984206-91984228 CAGTGTCCATTGCAGGGCCAGGG - Intergenic
935102564 2:100010840-100010862 CAGTCTCCATTTTAAATCCATGG - Intronic
936841567 2:116775866-116775888 CAGATACCACTTCAGAGCCAGGG - Intergenic
937829924 2:126408497-126408519 AAGGGTCCATTTCACATCCAGGG - Intergenic
938614412 2:132982519-132982541 CAGCTTTTATTTTAGATCCAGGG + Intronic
938669134 2:133570512-133570534 TAGTTTTCATTTCTGATCCAAGG + Intergenic
938802281 2:134774328-134774350 CAGTTTCCATGTCTGAACAATGG + Intergenic
939239940 2:139544455-139544477 CAGTTTCTAATTCATATCTATGG - Intergenic
939591181 2:144065570-144065592 CACTTGCCCTTTCAGACCCAGGG + Intronic
941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG + Intergenic
941782701 2:169461989-169462011 CAGGTTGCATTCCAGATCAATGG - Intergenic
945921828 2:215762669-215762691 CAGTTTCCATTTCAAATTGAGGG - Intergenic
946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG + Intergenic
946188075 2:217992407-217992429 CAGCCTCTATTTCAGACCCAGGG - Intronic
1168951771 20:1807058-1807080 CAGTTTCCCTTCCATATCCTAGG - Intergenic
1170869074 20:20188132-20188154 GATTTTCCAACTCAGATCCAAGG - Intronic
1173039217 20:39445195-39445217 CAACTTTCATTTTAGATCCAAGG + Intergenic
1174782535 20:53402947-53402969 CAGCTTTTATTTCAGATACACGG + Intronic
1176669263 21:9717293-9717315 CTGTCTCCATTTCAGATGCCAGG + Intergenic
1177206764 21:18018812-18018834 CAGTTTTTATTTTAGATACAAGG - Intronic
1177915277 21:27081323-27081345 CAGTTAGCCTTTCATATCCATGG + Intergenic
1178381434 21:32113000-32113022 CCACATCCATTTCAGATCCAAGG - Intergenic
1181486528 22:23235053-23235075 CAGTTCCCATTTCACCTCCTGGG + Intronic
1183019267 22:35014315-35014337 CAGTTTCCATTTCAGGTCCCAGG + Intergenic
1183142874 22:35960611-35960633 CATTTTCATTTTCAGATCAAGGG - Intronic
1185103023 22:48851762-48851784 CCGTTTCCATCTCAGATCTTTGG + Intergenic
949326700 3:2874169-2874191 CCAATTCCATTTCAGGTCCATGG + Intronic
950011422 3:9726868-9726890 CTGTTTCCTTATCAGAACCAAGG + Intronic
950758244 3:15195848-15195870 CAGCTTTTATTTCAGATACAAGG - Intergenic
950943210 3:16915886-16915908 CAGCTTACATTTCAGAAGCAGGG + Intronic
953679770 3:45030503-45030525 CAGCTACCTTTTCAGCTCCAGGG - Intronic
954091340 3:48286703-48286725 CTGTTTAAATTTCAGATCCAAGG - Intronic
954678764 3:52330210-52330232 TAGTTTCCATTCCAGGCCCAGGG + Intronic
955977599 3:64493091-64493113 CAGTTTTCATCTCAGCTGCAGGG + Intergenic
959644718 3:108685076-108685098 CAGTTTCCTTTTGAAATACATGG + Intronic
959899801 3:111647915-111647937 CAGTTCTCATTTCATGTCCACGG - Intronic
962040536 3:131702942-131702964 AGGTTTCCATCTCAGCTCCAAGG + Intronic
962385918 3:134932598-134932620 CAGTTTTCATTTCTGCTCAATGG + Intronic
963545574 3:146653678-146653700 CAGTGTCCGTTTCACATCCATGG - Intergenic
963779999 3:149477594-149477616 CAGTTTCCATGTGAGTTCAAAGG + Intronic
965497911 3:169420440-169420462 TAATTTGAATTTCAGATCCATGG - Intronic
965750987 3:171974937-171974959 CAGTTTTCACATCAAATCCAAGG - Intergenic
966249917 3:177853379-177853401 CAGTTTCCATTACTGAGGCAGGG + Intergenic
966980443 3:185129115-185129137 CAGTTTTTATTTTAGATACAGGG + Intronic
967126205 3:186426909-186426931 CACTTTGCATTTCAGGTGCATGG + Intergenic
970270441 4:14340789-14340811 GAGTTTTCATTTCACATACATGG + Intergenic
970660718 4:18282376-18282398 CATCTTCCATTTCAGATAGAAGG + Intergenic
970848141 4:20567681-20567703 CATTTTCCTTTTCAAATCAAAGG + Intronic
972252496 4:37318443-37318465 CAGCTTTCATTTTAGATTCAGGG + Intronic
974360553 4:60872928-60872950 CATATTCCATTTCAGATATAAGG + Intergenic
974563855 4:63557920-63557942 CAGCTTCTACTTCAGATTCAGGG + Intergenic
975218227 4:71781897-71781919 CAGTATCCATTTTAGACCCAAGG + Intronic
977415679 4:96729899-96729921 CAGTTTGGCTTACAGATCCAAGG - Intergenic
980083072 4:128364600-128364622 CAGTTCCCAATTCAGTTCCATGG - Intergenic
980213604 4:129822151-129822173 CAGTTTCCTTTTCCTGTCCAGGG - Intergenic
980893669 4:138840666-138840688 CAGCTTCTATTTTAGATACAGGG + Intergenic
980937924 4:139243883-139243905 CAGTTTCCATGGCAGTTCCATGG + Intergenic
982524210 4:156456985-156457007 CACTTTCATTTTCAGTTCCAAGG - Intergenic
982954189 4:161741575-161741597 CAGATTGCATTCCAGATCTAAGG + Intronic
986201750 5:5585521-5585543 GAGTTTCCATTTTAGTTCAAAGG - Intergenic
986382821 5:7203868-7203890 CAATTTTTATTTCAGATACAGGG - Intergenic
986763447 5:10900828-10900850 CAGTTCACATTTCAGGTGCATGG - Intergenic
986774870 5:11005198-11005220 CAGTTTCCACCTCAGAGCCTTGG - Intronic
987206764 5:15635414-15635436 CTGTGTCCATTTCAGAGCCCAGG - Intronic
990661328 5:58018893-58018915 CAGCTCCAATCTCAGATCCAAGG + Intergenic
991119118 5:62990523-62990545 CAATTTATATTTCAGATACAGGG - Intergenic
991551604 5:67842961-67842983 CAGTTTACATTTCAGACGCTAGG + Intergenic
997399181 5:133589318-133589340 CAGTCTCCCTTTCAGAAGCAAGG - Intronic
999530903 5:152462554-152462576 CAGTTTAGATTTCATATCAAGGG + Intergenic
1000888813 5:166779894-166779916 CAGTTTCCATTTCCGTACAATGG + Intergenic
1001940430 5:175736142-175736164 CAGCTGCCATCTGAGATCCAGGG + Intergenic
1002390140 5:178904481-178904503 AAGGTTCCATTTCAAGTCCACGG - Intronic
1003404501 6:5817305-5817327 CAGTTTCCATTCCAGACTCCTGG - Intergenic
1004785316 6:18961863-18961885 CACTTTCCATTTGAGCTCCTGGG + Intergenic
1008234885 6:49032825-49032847 AAATATCCATTTCAAATCCAAGG - Intergenic
1009060468 6:58392425-58392447 CAATTTTTATTTCAGATTCAGGG - Intergenic
1009230445 6:61054909-61054931 CAATTTTTATTTCAGATTCAGGG + Intergenic
1010485243 6:76403748-76403770 CAGATTTCATTGCAGCTCCAGGG - Intergenic
1013172280 6:107647542-107647564 TATTTTCCATTACACATCCAAGG - Intronic
1015361036 6:132339739-132339761 CAGTTTCTCTTTCACATCCAGGG - Intronic
1018479786 6:164178838-164178860 CAGCTTCCCTTTCAGATCTGTGG + Intergenic
1018954706 6:168401074-168401096 GTGTTTCCATTTCAGACCAAGGG + Intergenic
1023024301 7:36036958-36036980 CAGGTTCCATTTCTCATCAATGG + Intergenic
1023739394 7:43265226-43265248 CAGTTTCCATCTCAGAGGTAAGG + Intronic
1026513365 7:71045921-71045943 AAGTTTTCATTTTAGATTCATGG - Intergenic
1028278048 7:88882991-88883013 CAATTTTCATTTTAGATTCAGGG - Intronic
1028942598 7:96540623-96540645 CAACTTCTATTTCAGATTCAGGG + Intronic
1029318586 7:99736808-99736830 CAGATTCCTTGTCAGATTCAAGG + Intergenic
1029323516 7:99785794-99785816 CAGATTCCTTGTCAGATTCAAGG + Intergenic
1031046056 7:116889098-116889120 CAGTTTAAATTTCAGATCTATGG - Intronic
1031894820 7:127336803-127336825 CATTGTCCACTTCTGATCCATGG - Intergenic
1033458938 7:141527994-141528016 GAGTTTCAAGTTAAGATCCAAGG + Intergenic
1033599972 7:142882336-142882358 CAGTTTCCTTTTCTGAAGCATGG - Intronic
1036609692 8:10339165-10339187 CAGTTTTCATTCCAAAGCCAAGG - Intronic
1037048972 8:14345114-14345136 AAGTTTCCATTTCAGTTCATTGG - Intronic
1037745549 8:21641296-21641318 CAGACTGCATTTCAGGTCCATGG + Intergenic
1039242836 8:35575372-35575394 CAGATGCCATGTTAGATCCATGG - Intronic
1039268079 8:35850078-35850100 CAGCTTTCATTTCAGATACATGG + Intergenic
1039320894 8:36429824-36429846 AAGTTTCCATTTTATATACAGGG + Intergenic
1041421781 8:57674982-57675004 GAGTTTCCATTTCAGACAAATGG + Intergenic
1041640141 8:60189938-60189960 AAGTTTCCTTTTCTTATCCAAGG + Exonic
1043017691 8:74961201-74961223 CAGTGTCCTTTTCTGTTCCAGGG + Intergenic
1043603568 8:81971516-81971538 TTGTTCCCATTTCTGATCCATGG + Intergenic
1043989276 8:86732893-86732915 CAGTTTTTATTTTAGATTCAGGG + Intronic
1047835519 8:128686192-128686214 CAGCTTTTATTTCAGATACAAGG + Intergenic
1048602561 8:135933536-135933558 CTGTTTCTATTTCATATTCAGGG - Intergenic
1049080891 8:140442763-140442785 CAGTTTGCAATTAAAATCCAAGG + Intronic
1049237064 8:141517736-141517758 CAGCTTCAAGGTCAGATCCAGGG - Intronic
1051326475 9:15976349-15976371 CGGTTTCCATTTTATATTCATGG + Intronic
1052278085 9:26701374-26701396 CAGCTTCTATTTTAGATCCATGG - Intergenic
1052601704 9:30640572-30640594 CAGTTTCTATTTCAGATGACAGG - Intergenic
1054999082 9:71427899-71427921 CAACTTTTATTTCAGATCCAGGG - Intronic
1055625006 9:78167609-78167631 CAGATTCCATGTCAGATCACCGG - Intergenic
1056259599 9:84834576-84834598 CACTTTCCATTTCAAATCGGAGG + Intronic
1056572892 9:87831572-87831594 CAGTTTCCTTTCCAGAGCAAAGG - Intergenic
1057806859 9:98225651-98225673 CAGTTTCCCTTTCAGAGTAAGGG + Intronic
1059679332 9:116571090-116571112 CAGCTTCCATTTCATCTCCAGGG - Intronic
1062041160 9:134404944-134404966 CATTTCCCCTTTCAGATCCTTGG - Intronic
1203656603 Un_KI270753v1:3643-3665 CTGTCTCCATTTCAGATGCCAGG - Intergenic
1185779305 X:2830614-2830636 CTGTTTCCAGTACAGATACAGGG + Intronic
1185852271 X:3500270-3500292 CAGATACCCTTTCAGATGCATGG - Intergenic
1188018102 X:25127070-25127092 CAATTTTTATTTTAGATCCAGGG - Intergenic
1188956001 X:36435697-36435719 CAGTCTCCAGTGCAGATCGAGGG + Intergenic
1189519093 X:41747187-41747209 AAGTTTCCATTTCACACCTAAGG + Intronic
1190747932 X:53337283-53337305 AAGTTTCTATTCCAGATACAAGG + Intergenic
1190937935 X:55013418-55013440 CAGCTTCTCTTTCAGATCCTGGG + Intronic
1191800812 X:65077330-65077352 CAATTTCCATTCCAAACCCAGGG - Intergenic
1192289061 X:69772494-69772516 CAATTTTCATTTTAGATTCAGGG + Intronic
1193771222 X:85589954-85589976 CATTTTCAATTTCAGGTTCAGGG - Intergenic
1193786239 X:85762747-85762769 CAGTTTCTACTTTAGATTCAGGG + Intergenic
1194072519 X:89344567-89344589 CAGTTTTTATTTTAGATACAAGG + Intergenic
1194990778 X:100544330-100544352 GAGTTCCCATTTGAGAGCCAGGG - Intergenic
1195298579 X:103504314-103504336 CAGCTTTTATTTTAGATCCAGGG - Intronic
1195960918 X:110385674-110385696 CAACTTCCATTTTAGATTCAGGG + Intronic
1195988917 X:110663228-110663250 TAGTTTTCATTTTAGATTCAGGG - Intergenic
1196483833 X:116181493-116181515 CATTCTCCAATTCAGATTCAGGG - Intergenic
1197088123 X:122503532-122503554 CAGCTTTTATTTCAGATTCAGGG + Intergenic
1197235464 X:124057776-124057798 CTGTTTCAATTTCATATCTAAGG - Intronic
1199122100 X:144067307-144067329 AAGTTTCTATTTCAGAAGCAGGG + Intergenic
1199891118 X:152083178-152083200 CAATTTTTATTTCAGATTCAGGG - Intergenic
1200012529 X:153129610-153129632 CTTTTTCCATTTCAGAACCTTGG + Intergenic
1200027070 X:153270309-153270331 CTTTTTCCATTTCAGAACCTTGG - Intergenic
1200069351 X:153520055-153520077 CCTTCTCCATTCCAGATCCAGGG + Intronic
1200726759 Y:6680314-6680336 CAGTTTTTATTTTAGATACAAGG + Intergenic
1200727911 Y:6696090-6696112 CAGTTTTTATTTTAGATACAAGG + Intergenic
1202082898 Y:21103125-21103147 CAGATTGCATAGCAGATCCATGG + Intergenic