ID: 1153794711

View in Genome Browser
Species Human (GRCh38)
Location 18:8610780-8610802
Sequence AACCCCGTTCTTTAAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153794708_1153794711 2 Left 1153794708 18:8610755-8610777 CCTTAAAAGATGTCCAAACTAGG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1153794711 18:8610780-8610802 AACCCCGTTCTTTAAAATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 164
1153794707_1153794711 3 Left 1153794707 18:8610754-8610776 CCCTTAAAAGATGTCCAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1153794711 18:8610780-8610802 AACCCCGTTCTTTAAAATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 164
1153794706_1153794711 4 Left 1153794706 18:8610753-8610775 CCCCTTAAAAGATGTCCAAACTA 0: 2
1: 0
2: 1
3: 19
4: 268
Right 1153794711 18:8610780-8610802 AACCCCGTTCTTTAAAATAAAGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153794711 Original CRISPR AACCCCGTTCTTTAAAATAA AGG Intronic
905068382 1:35204093-35204115 ACCCCCTTTTTTTAAGATAAGGG + Intergenic
910466491 1:87505871-87505893 AAACCTGTTATTTAATATAATGG + Intergenic
915779417 1:158529779-158529801 AAAACAATTCTTTAAAATAAAGG + Intergenic
917954917 1:180085144-180085166 AACACCATTCTGTGAAATAAGGG - Intronic
919674216 1:200365763-200365785 AACCCAGCTCTTTATAACAATGG - Intergenic
924642719 1:245849370-245849392 TACACCGTGCTTTAAGATAAAGG + Intronic
924910639 1:248508753-248508775 AAGACTGCTCTTTAAAATAAAGG - Intergenic
924913461 1:248539286-248539308 AAGACTGCTCTTTAAAATAAAGG + Intergenic
1062931460 10:1355240-1355262 AACACTGTTCATTAAAATAGAGG - Intronic
1063304457 10:4884226-4884248 AACCCCTTGATTTAAAAAAAAGG - Intergenic
1064659173 10:17588704-17588726 AACCAAGTTATTTAAAGTAAAGG + Intergenic
1068306944 10:55223771-55223793 AACTCTGGTCTTTAAAATAAAGG + Intronic
1068583131 10:58765466-58765488 AAACATGTTCTTTAAAGTAACGG + Intronic
1068901234 10:62271167-62271189 AACCACATTTTTCAAAATAATGG - Intergenic
1071285747 10:84142963-84142985 AATCCTTTTCTTTAAAAAAAAGG - Intronic
1071740194 10:88349468-88349490 ATCTCTGTTATTTAAAATAAAGG - Intronic
1073627566 10:105115130-105115152 AACCCAGGTCTTTAAAGTCAGGG - Intronic
1074032052 10:109698557-109698579 TAACATGTTCTTTAAAATAAAGG + Intergenic
1074335045 10:112564595-112564617 ACCCCCCTTTTTTTAAATAATGG + Intronic
1074613040 10:115039444-115039466 AGCCACATTCTTTAAATTAAAGG - Intergenic
1076593093 10:131603773-131603795 AAAACTGTTCTTTAAAATGAGGG - Intergenic
1080684351 11:34503000-34503022 AACCTCATTCTTTAAAATTGTGG + Intronic
1080890203 11:36402637-36402659 ATCCCTGTTCTTTAAAGGAAAGG + Intronic
1082682266 11:56189672-56189694 AACACAGTGCATTAAAATAATGG + Intergenic
1082853770 11:57788386-57788408 AACCACGTTCTTTAAACTTAGGG + Intronic
1082953619 11:58845424-58845446 AACCCCAGTCTTTAAAATTTTGG + Intronic
1084579365 11:70013382-70013404 AACCTCCTTTTTTAAAAAAAAGG - Intergenic
1084919659 11:72458791-72458813 AACCCAGTTCTTCAAGATGATGG - Intergenic
1085086993 11:73675105-73675127 AACCCCTTACTGTAAAATGAAGG - Intergenic
1086972408 11:93097861-93097883 AACCATGTTCTTTAAAAATATGG - Intergenic
1088742143 11:112775882-112775904 GACCCCGGTATTTAAAAGAAAGG - Intergenic
1092702264 12:11245450-11245472 AACCCATTTTTTTAAAAAAATGG + Intergenic
1096826924 12:54286514-54286536 GACCCATTTCCTTAAAATAATGG + Intronic
1097147034 12:56948857-56948879 AACCCAGTGCTTTCAAAGAAAGG - Intergenic
1100075569 12:90778623-90778645 ATTCTCGTTCTTTAAAATACTGG - Intergenic
1101850711 12:108399856-108399878 AGCCCCGTTCTATGAAATAGAGG - Intergenic
1106962126 13:35010902-35010924 ACCCCATTTCTTTAAAAAAAGGG + Intronic
1109779351 13:67087226-67087248 AAGCCCCTTCTTTGAAATACAGG - Intronic
1110055510 13:70965669-70965691 CACTGCGTTCTTTATAATAAAGG - Intergenic
1110105299 13:71667477-71667499 ACCCCATTTCATTAAAATAATGG + Intronic
1112769985 13:102784274-102784296 AACGTAGTCCTTTAAAATAAAGG + Exonic
1115837805 14:37428625-37428647 AACCCACTTTTTTAAAAAAAAGG - Intronic
1116174960 14:41456801-41456823 AAGCTTGTTCTTTAAAAGAATGG + Intergenic
1118127320 14:62921329-62921351 AAATCTGTTCTTTAAAATACAGG + Intronic
1118588543 14:67380993-67381015 AACCCCTCTTTTTAAAAAAAGGG - Intronic
1122680504 14:103457910-103457932 GACCCCGTTCTCCACAATAAGGG - Intronic
1122992966 14:105247441-105247463 AACCCAGTTTTTTAAAAAACGGG - Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1127986220 15:64073333-64073355 AACCCTGTAGTTTAAAATATAGG - Intronic
1128869911 15:71146803-71146825 AACCCCCATCTGTAAAATGACGG + Intronic
1129646598 15:77440003-77440025 AGCCCCCTTTTTTAAAAAAATGG + Intronic
1130039008 15:80388259-80388281 AGCCCCGTGCTTTATAATTAGGG - Intronic
1135499751 16:22984617-22984639 AACCTTGTTTTTTAAAAAAATGG - Intergenic
1135822952 16:25700801-25700823 AACCACCTTCTTTTAATTAATGG - Intronic
1137922694 16:52506531-52506553 ACCCCCCTTCTTTAAAAGAAGGG - Intronic
1138257753 16:55582262-55582284 AACCCCCTTCTTTAAGAGAGAGG - Intronic
1140160997 16:72494453-72494475 AACTCCGTTCTCTAGAATGAAGG + Intergenic
1140896495 16:79329242-79329264 AACCCAGTTCCTTATAAGAAGGG + Intergenic
1145216306 17:21055084-21055106 AACCTTGTTCTGTAAAATCACGG + Intergenic
1153191007 18:2538616-2538638 AGCCCCATTTTTTAGAATAATGG + Exonic
1153480898 18:5544575-5544597 ACCTCCGCTCTTTAAAATCAAGG - Intronic
1153794711 18:8610780-8610802 AACCCCGTTCTTTAAAATAAAGG + Intronic
1155805071 18:30159529-30159551 AAACACGTGCTTTAAGATAAAGG - Intergenic
1156000592 18:32379961-32379983 TACACCCTTTTTTAAAATAAAGG + Intronic
1156328555 18:36097570-36097592 AACCTAGTTCTTTAAAATGTGGG - Intergenic
1156745501 18:40386373-40386395 AACCCCTATCTCTAAAATATTGG + Intergenic
1157765731 18:50295766-50295788 CACCCCTTTCCTTAAAAAAAAGG + Intergenic
1161549259 19:4902347-4902369 AACCCCGATATTCAAAATGAAGG - Intronic
1165416092 19:35694307-35694329 GACCCCGTCTTTTAAAAGAAAGG - Intergenic
1165697402 19:37911346-37911368 AACCCAGTTTTTTCAATTAATGG + Intronic
927945676 2:27133901-27133923 CACCCTGTTCTGTAAAATAGAGG - Intronic
928115405 2:28542432-28542454 AACTCTGTTCTGTAAAATCAGGG + Intronic
933301196 2:80543537-80543559 AACCCTATTCTTTACACTAATGG + Intronic
935489841 2:103704623-103704645 AACTCCGCTCTTTAATATTATGG - Intergenic
936121298 2:109747853-109747875 AACCCAGTTGTTTAACATCAAGG + Intergenic
936223399 2:110623618-110623640 AACCCAGTTGTTTAACATCAAGG - Intergenic
936555559 2:113495937-113495959 AATACCATTCTTTAAAAAAAAGG - Exonic
936625026 2:114139646-114139668 AACTCCTTTATTTAAAAAAATGG + Intergenic
941482847 2:166039223-166039245 AACTATGTTCTTTGAAATAAAGG + Intronic
941632636 2:167901559-167901581 AAACCTGTTTTTAAAAATAATGG + Intergenic
942143999 2:173007925-173007947 AAGCCCCTTCTGTAAAATAGGGG + Intronic
942999593 2:182309208-182309230 AACATGGTTCTGTAAAATAAAGG - Intronic
944378811 2:199081967-199081989 ACCCCCATTTTTAAAAATAAAGG - Intergenic
946902976 2:224390187-224390209 AACCCAGTTCTTTTAATTAAGGG - Intronic
947111791 2:226726463-226726485 AACCATGTTCTTTAAAATCCTGG - Intergenic
947251112 2:228105413-228105435 AACCTCATTATTTAAAAGAAAGG - Intronic
947350241 2:229236001-229236023 TACCCCTTTCTTCAAAATACAGG - Intronic
948061612 2:235046560-235046582 AAACCCTGTCTTGAAAATAAAGG + Intronic
948585025 2:239013991-239014013 AAGCCCCTTTTTAAAAATAATGG + Intergenic
1171162079 20:22936241-22936263 AACATCATTCCTTAAAATAAGGG - Intergenic
1171857778 20:30363007-30363029 AACCCCGTCTTTTAAATTACAGG + Intergenic
1173150014 20:40558969-40558991 AGCCCCGTTCTTTCAAGTAAAGG - Intergenic
1176150462 20:63588209-63588231 AACCCTGTTCTTAAAAAGAAAGG + Exonic
1177542920 21:22519493-22519515 AACACAGTTCCTTCAAATAAGGG + Intergenic
1180390636 22:12278958-12278980 AACCCCGTCTTTTAAATTACAGG - Intergenic
1180409107 22:12585799-12585821 AACCCCGTCTTTTAAATTACAGG + Intergenic
1183249022 22:36715387-36715409 AATCCCATTCTGTAAAAGAATGG - Intergenic
951727693 3:25778331-25778353 GTCTCAGTTCTTTAAAATAAGGG - Intronic
955378548 3:58418118-58418140 AAACCCATTTTTTAAAAAAAGGG - Intronic
955930591 3:64052580-64052602 AACTCAGTTTTTTAAAATATGGG + Intergenic
956424155 3:69115622-69115644 AACCTCGTTCTTGAAAATCCAGG + Intronic
957197330 3:77086145-77086167 AACCACGATCTATAAGATAACGG - Intronic
958740301 3:98060944-98060966 AAATCCATTCTTTAAAAAAAAGG - Intergenic
959225141 3:103571487-103571509 AATATCTTTCTTTAAAATAAAGG + Intergenic
959330900 3:105003317-105003339 AACACCCTTCTTTCAAATAAAGG + Intergenic
959921567 3:111873974-111873996 AACACCGTTTTTTAAAATCTAGG - Intronic
964147871 3:153487590-153487612 TTTCCCTTTCTTTAAAATAAAGG - Intronic
964363540 3:155924184-155924206 AAGTCAGTTCTTTAAAACAATGG - Intronic
966484840 3:180456641-180456663 AACCCAGTTGTTTCAAAAAATGG - Intergenic
972729261 4:41777137-41777159 AAACCTATTCTTTAGAATAAAGG - Intergenic
973047408 4:45551854-45551876 AACCCCTCTCTTTAGAATAGGGG - Intergenic
975684769 4:76908809-76908831 AACTGTGTTCCTTAAAATAATGG + Intergenic
977358346 4:95974841-95974863 AACGCTGCTCTTTAAAGTAAAGG + Intergenic
977733883 4:100388026-100388048 AACCCAGGCCTTTAATATAAAGG + Intergenic
978128950 4:105170487-105170509 AACCCATCTCTTTAAAAAAATGG + Intronic
980779133 4:137474338-137474360 AACCCCATTCTTAAAGATGAAGG - Intergenic
981269759 4:142831562-142831584 TACCATGTTCTTTAAATTAATGG - Intronic
981468367 4:145099521-145099543 AACTCCCTTTTTTAAAATAGGGG - Intronic
981686422 4:147459616-147459638 GACAGTGTTCTTTAAAATAAAGG - Intergenic
983816494 4:172134508-172134530 TACCCAGTTGTTTAATATAAAGG - Intronic
984252783 4:177354491-177354513 ATCCACGTTCTTTAACAGAAAGG - Intronic
988886720 5:35565805-35565827 TACTCCTTTCTTTAAAAGAAAGG - Intergenic
989314567 5:40062771-40062793 AACTCCCTTCATTAAAATATTGG - Intergenic
990709833 5:58567998-58568020 AACCCCTTTCTCTGAAGTAAGGG - Intergenic
990883381 5:60564992-60565014 AATCTCACTCTTTAAAATAATGG + Intergenic
993089423 5:83406157-83406179 AAAACTGTTGTTTAAAATAATGG - Intergenic
993979198 5:94523450-94523472 AACCCAGTTCTTTTCAATCAAGG - Intronic
996434536 5:123420404-123420426 AACCATTTTCTTTTAAATAAAGG + Intronic
1000556029 5:162727032-162727054 AACAGTGTTCTTTAAAATAAAGG + Intergenic
1000672302 5:164077625-164077647 AACCCTCTTATTTAAAATAATGG + Intergenic
1002414003 5:179108990-179109012 AAGCTCCTTCTTTAAAAGAAGGG + Intergenic
1002444454 5:179280566-179280588 AACCCACTCCTGTAAAATAAAGG + Intronic
1007559443 6:42794311-42794333 AACCATGTTGTTTAAAAAAAAGG + Intronic
1008857256 6:56104755-56104777 AAGACAGTTCTTTAAAAAAAAGG + Intronic
1011649266 6:89490884-89490906 AAAACCTTTTTTTAAAATAAGGG - Intronic
1011898768 6:92265431-92265453 AACCTCATTCTTTCAAAGAAGGG - Intergenic
1016336968 6:143017399-143017421 AACCCCATTTTATAAAATTAAGG - Intergenic
1021500127 7:21323655-21323677 AATCCCTTTATTTAAACTAAAGG - Intergenic
1021997300 7:26192769-26192791 GACCCTATTCTTTTAAATAAAGG + Intronic
1022057957 7:26759782-26759804 TATCCCCATCTTTAAAATAAAGG + Intronic
1022857799 7:34332798-34332820 AACCCCATACTTTAAAAAATAGG - Intergenic
1023199992 7:37686554-37686576 AACCCTGTTCTAAAATATAAAGG - Intronic
1027523523 7:79239093-79239115 CACCATGTTTTTTAAAATAATGG + Intronic
1027939980 7:84665428-84665450 AACCACATTCTTTAAAAGCAAGG - Intergenic
1028486261 7:91360849-91360871 AAACCCCTTCTTTAAAAAAAAGG + Intergenic
1030226816 7:107161962-107161984 CACACCTTTATTTAAAATAAGGG - Intergenic
1031941561 7:127794725-127794747 AACCCCGTTACTTAAAGTACAGG - Intronic
1032235893 7:130122557-130122579 AGACCCTTTCTTTAAAAAAAGGG - Intronic
1037361774 8:18082012-18082034 AAACGTGTTCTTAAAAATAACGG - Intronic
1041822730 8:62056965-62056987 AATCTGGTTCTTTAAAAGAAAGG + Intergenic
1041966067 8:63678508-63678530 AACCATGTTATTTAAAATTATGG - Intergenic
1046003106 8:108444782-108444804 AACACTGTTGTTTAATATAATGG - Intronic
1046136730 8:110036825-110036847 AACCCCTTACACTAAAATAAGGG + Intergenic
1046445098 8:114308316-114308338 AATCTTGTTCTTTAAAACAAAGG - Intergenic
1049897434 9:121251-121273 AATACCATTCTTTAAAAAAAAGG + Exonic
1053723879 9:40976516-40976538 AACCCCGTCTTTTAAATTACAGG + Intergenic
1053740529 9:41131518-41131540 AATACCATTCTTTAAAAAAAAGG + Exonic
1054342081 9:63875483-63875505 AACCCCGTCTTTTAAATTACAGG - Intergenic
1054443522 9:65287693-65287715 AATACCATTCTTTAAAAAAAAGG + Intergenic
1054486754 9:65733810-65733832 AATACCATTCTTTAAAAAAAAGG - Intronic
1054687820 9:68299781-68299803 AATACCATTCTTTAAAAAAAAGG - Exonic
1054964958 9:71013859-71013881 AAGCCAGTTCTTAAAAATATAGG - Intronic
1056548821 9:87635011-87635033 ACTCCCCTTCTATAAAATAAAGG - Intronic
1058352096 9:104038059-104038081 AATTCAATTCTTTAAAATAAAGG - Intergenic
1059214787 9:112550970-112550992 AACCCCATTCATTCAAAGAAAGG - Intronic
1059644204 9:116248361-116248383 GACCCCTGTCTATAAAATAAAGG + Intronic
1060052154 9:120385216-120385238 ATCCCCCTTGTTTAAAATATGGG - Intergenic
1060903498 9:127282593-127282615 ATCCCCTTTCTTTAAAATGAGGG - Intronic
1185993609 X:4918969-4918991 AACCCAATTCTTCAAAAAAATGG + Intergenic
1186613408 X:11161047-11161069 AACCACATTCTAAAAAATAAAGG + Intronic
1186668177 X:11740484-11740506 AACACCTTTATGTAAAATAAAGG - Intergenic
1187245355 X:17548953-17548975 AACCCCGTTCTTAAAAAAAAGGG - Intronic
1195927712 X:110042854-110042876 AACCCAGTTTTTTCAAAAAATGG - Intronic
1195975915 X:110526615-110526637 CACCCTCTTTTTTAAAATAAAGG + Intergenic
1199052939 X:143258648-143258670 TACCCCATGCTTTAAGATAATGG - Intergenic
1200757517 Y:7003791-7003813 CTCCCCCTTTTTTAAAATAAGGG + Intronic
1201411124 Y:13700462-13700484 AACCCCGTTATATATACTAAAGG - Intergenic