ID: 1153794714

View in Genome Browser
Species Human (GRCh38)
Location 18:8610783-8610805
Sequence TGCCCTTTATTTTAAAGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153794714_1153794721 19 Left 1153794714 18:8610783-8610805 CCCGTTCTTTAAAATAAAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 352
Right 1153794721 18:8610825-8610847 GTGAGAGATTTCCCCAGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 129
1153794714_1153794719 15 Left 1153794714 18:8610783-8610805 CCCGTTCTTTAAAATAAAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 352
Right 1153794719 18:8610821-8610843 GGAAGTGAGAGATTTCCCCAGGG 0: 1
1: 1
2: 1
3: 51
4: 478
1153794714_1153794716 -6 Left 1153794714 18:8610783-8610805 CCCGTTCTTTAAAATAAAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 352
Right 1153794716 18:8610800-8610822 AGGGCAGTCACTTCCGTGATAGG 0: 1
1: 0
2: 0
3: 3
4: 90
1153794714_1153794718 14 Left 1153794714 18:8610783-8610805 CCCGTTCTTTAAAATAAAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 352
Right 1153794718 18:8610820-8610842 AGGAAGTGAGAGATTTCCCCAGG 0: 1
1: 1
2: 4
3: 20
4: 232
1153794714_1153794720 16 Left 1153794714 18:8610783-8610805 CCCGTTCTTTAAAATAAAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 352
Right 1153794720 18:8610822-8610844 GAAGTGAGAGATTTCCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153794714 Original CRISPR TGCCCTTTATTTTAAAGAAC GGG (reversed) Intronic
900932636 1:5746714-5746736 TGCCTTTTTTTTTAAGCAACTGG + Intergenic
901603409 1:10440215-10440237 TGCCCTTTATCTAAAAGGATGGG + Intronic
902176080 1:14652226-14652248 TGCTCTTCACTTTAAACAACTGG + Intronic
904864106 1:33562936-33562958 TGCAATTTATTTTAAGGAACTGG - Intronic
905479005 1:38248458-38248480 TGCCCTTCCTTATAAAGAAACGG - Intergenic
905955085 1:41986114-41986136 TTCCCTTGATTTTAAAGATGAGG - Intronic
907037704 1:51230794-51230816 TGCCATTTATTAGACAGAACTGG - Intergenic
907063461 1:51455104-51455126 TGCTTTTTATTTTAAAGAAAAGG - Intronic
907619969 1:55967568-55967590 TTCCCTCTATTCTAAAGAAGAGG - Intergenic
907620204 1:55970197-55970219 TGGCGATTATTTTAAAGCACCGG - Intergenic
908713215 1:67041314-67041336 TACCTCTTCTTTTAAAGAACTGG - Intronic
909184465 1:72469019-72469041 TGTTCTCTATTTTAAAGAAAAGG - Intergenic
909857115 1:80549202-80549224 TGTCTTGTATTTTAAAAAACTGG - Intergenic
909977498 1:82062375-82062397 TTTTCTTTGTTTTAAAGAACTGG + Intergenic
910243786 1:85117238-85117260 TTCACTTTTTTTTAAAAAACTGG - Intronic
910466493 1:87505874-87505896 TACCCATTATATTAAATAACAGG - Intergenic
911877929 1:103192950-103192972 TGGACATTATTTTATAGAACAGG - Intergenic
914441790 1:147714052-147714074 TGCCATTTTTTCTAAACAACAGG + Intergenic
915592976 1:156881004-156881026 TGGCTTTCATTTTAAAGAAGAGG - Intronic
917655635 1:177122771-177122793 TCCTCCTTATTTCAAAGAACTGG + Intronic
918564484 1:185912238-185912260 TGTCCTTTACTTTACAGAATTGG + Intronic
919479270 1:198066798-198066820 TTCATTTAATTTTAAAGAACTGG - Intergenic
919486279 1:198151558-198151580 TGCCCTTACTTTTAAGGAAGAGG + Intergenic
919989561 1:202699917-202699939 AGCTCTTTATTTTAAAGACAAGG - Intronic
920399268 1:205667064-205667086 TGCAATTTATTTTAAACAATAGG - Intronic
920689237 1:208133072-208133094 AGCCCTTTATTTTACAGAAGAGG - Intronic
920871561 1:209799254-209799276 TGCCCTTTCTGATCAAGAACTGG - Intronic
922860028 1:228808468-228808490 AGAGATTTATTTTAAAGAACTGG - Intergenic
924803702 1:247346372-247346394 TGTACAATATTTTAAAGAACAGG - Intergenic
924855374 1:247870182-247870204 TGCCCATTATTTTAAATTAAAGG - Intronic
1063014223 10:2059074-2059096 TAACATTTATTTTCAAGAACAGG + Intergenic
1065689390 10:28317523-28317545 TACCCTTTATTTTTAAATACAGG - Intronic
1066065258 10:31757040-31757062 TTCCGTTTATTTTAAAGATACGG - Intergenic
1066161185 10:32731162-32731184 TGCCTTTTATTTTTATGAAAGGG + Intronic
1066761053 10:38753714-38753736 CTCCCTTTGTTTTAAAGAAATGG - Intergenic
1067700927 10:48571428-48571450 GGCACTATATTTTCAAGAACAGG - Intronic
1068181140 10:53519899-53519921 TGCCCTTTATTTTAGAAGCCTGG - Intergenic
1068786973 10:60987383-60987405 TGCCACTGATTTTAAGGAACAGG - Intronic
1069178567 10:65326517-65326539 TACCTTTTATTTTAAGGAACTGG + Intergenic
1069608852 10:69758857-69758879 TTCCCTTCATTTCCAAGAACAGG - Intergenic
1069746799 10:70720229-70720251 TGCCCTATATTTTAAAGGGCTGG - Intronic
1071285746 10:84142960-84142982 TTTCCTTTTTTTTAAAGAAAAGG + Intronic
1071320519 10:84451273-84451295 TGTTTTTTTTTTTAAAGAACAGG + Intronic
1074752134 10:116596694-116596716 TGCCCTTGATTTCAAAGAGAAGG - Intronic
1074936781 10:118189898-118189920 TTTCCTTTATTTTGAAGAAACGG - Intergenic
1078749358 11:14145218-14145240 TGCCAGTTTTATTAAAGAACAGG - Intronic
1079429316 11:20373523-20373545 TTCCCTTATTTTTAAAGAAACGG + Intronic
1080890205 11:36402640-36402662 TGGCCTTTCCTTTAAAGAACAGG - Intronic
1080936344 11:36868018-36868040 TGCCCTTTATTTTGAAGGGAGGG - Intergenic
1081220094 11:40449512-40449534 AGCCCTTTATTTTAAAGCTAGGG + Intronic
1081539356 11:44018795-44018817 TTCCTTTTATTTTTAAGAAATGG - Intergenic
1081903385 11:46648981-46649003 TGCCCTTTTATTTAGAGAAGAGG + Intronic
1082096723 11:48136984-48137006 GGCCCTTGATTTTAAAAAAAAGG - Exonic
1082220994 11:49636566-49636588 TTCCCTGTATTTTAAAAACCTGG + Intergenic
1082641043 11:55662026-55662048 TGCCCTTTATTTAAGAAAATAGG + Intergenic
1083693634 11:64427644-64427666 TGTCCTTTATTTTACTGAAAGGG + Intergenic
1086335186 11:85793641-85793663 TGTCCTTCATTTTTAAGGACAGG - Intronic
1086981407 11:93202075-93202097 TGCCCTTTCTTAGAAAGCACTGG + Intergenic
1088332077 11:108664862-108664884 TGCGTTTTTTTTTAAAGAGCCGG + Intergenic
1088442887 11:109891147-109891169 TGACATTTATTTTAAATAAAAGG - Intergenic
1089200634 11:116722806-116722828 TGCCCTTTTTCTTAGAGGACAGG - Intergenic
1089625148 11:119746325-119746347 GTCCCTTTCTTCTAAAGAACAGG - Intergenic
1090315681 11:125785825-125785847 TGCCTTTTATTTTAGGGAAATGG - Intergenic
1091947550 12:4562006-4562028 TGCCCTATACTTTAAAGAACTGG + Intergenic
1093115865 12:15210333-15210355 TGTCCTTTATTTTAAACTAATGG - Intronic
1094250119 12:28350253-28350275 TGCCATTTCTTTTAAAGATCTGG + Intronic
1094605234 12:31943831-31943853 TGCCCTGCCTTTTAAAAAACAGG + Intergenic
1095199953 12:39372144-39372166 AACCTTTTATTTTAATGAACTGG - Intronic
1096913825 12:55010797-55010819 TTCCCTTTATTCTTAAGCACTGG - Intergenic
1100686401 12:96991231-96991253 TGCTTTTTTTTTTAAAGAAAAGG + Intergenic
1101351699 12:103935716-103935738 TGCCCTCTCTTTTTAAGCACTGG + Intronic
1101695787 12:107124808-107124830 TGTCCTTTTTTTTAAAAAAATGG + Intergenic
1104110260 12:125698006-125698028 TGTCCTTTATTTTACAGGAGGGG + Intergenic
1104193992 12:126513110-126513132 TTCCTTGTATTCTAAAGAACAGG + Intergenic
1105618817 13:22047181-22047203 GGATATTTATTTTAAAGAACTGG + Intergenic
1105717595 13:23082634-23082656 TGCTCTTTGTTTTAAAAAATTGG + Intergenic
1105959413 13:25316444-25316466 TGACTTTTTTTTTAAAAAACTGG + Intronic
1106801183 13:33257673-33257695 TACCCTTACTTTTTAAGAACTGG + Intronic
1106806701 13:33315744-33315766 TGTCATTTATTTTAATGAAATGG - Intronic
1107978084 13:45709132-45709154 TACCCTTCATTTTACAGAAGTGG + Intronic
1108258038 13:48629420-48629442 AGACATTTATTTTAAAGAATTGG + Intergenic
1109599774 13:64609722-64609744 TGCCGATTCTGTTAAAGAACTGG + Intergenic
1110048011 13:70855820-70855842 TGCCATTTATCTGAAAGAAAAGG + Intergenic
1110216246 13:73027839-73027861 TACACTTTTTTTGAAAGAACAGG - Intergenic
1110247991 13:73348772-73348794 TGCCCTTTAATTAGAAAAACAGG + Intergenic
1110714678 13:78688007-78688029 TGAACTTTATTTTTTAGAACAGG + Intergenic
1111264923 13:85796527-85796549 TGCGTTTTATTTTACAGAATCGG - Exonic
1111858500 13:93671131-93671153 TTGGCATTATTTTAAAGAACAGG + Intronic
1111925765 13:94461938-94461960 TGCCTGTGATTGTAAAGAACTGG - Intronic
1112599827 13:100843990-100844012 AGCCCTTTTTCTTAAAGGACGGG + Intergenic
1113166366 13:107447987-107448009 TGCCCTGTATTTGAAAGAGCAGG - Intronic
1115042909 14:28953541-28953563 TAATTTTTATTTTAAAGAACTGG + Intergenic
1115112666 14:29842319-29842341 TGTGCTATATTTTAAACAACTGG + Intronic
1115762871 14:36592716-36592738 CACCCTTTATTTGAAAGAAATGG + Intergenic
1115837803 14:37428622-37428644 TGGCCTTTTTTTTAAAAAAGTGG + Intronic
1115850248 14:37584693-37584715 TGGTCTTTATTTTTAAGCACTGG + Intergenic
1115867392 14:37762150-37762172 TTCCCTTTTTTTTTAAGAAAAGG + Intronic
1115919624 14:38358088-38358110 AGAGATTTATTTTAAAGAACTGG + Intergenic
1115992513 14:39164538-39164560 TGGACTTTATTTTGAAGAAAGGG - Intronic
1117529568 14:56646100-56646122 TTCCCTTTATTTTATACAATAGG - Intronic
1117659704 14:57990947-57990969 TATCTTTTATTTTAAAGAAAAGG - Intergenic
1118004162 14:61550495-61550517 TGCCCAGTATTGTAAACAACAGG + Exonic
1121182786 14:91942174-91942196 TGGACTTTATTTTAAGCAACAGG - Intronic
1121604033 14:95227274-95227296 TGCCCTGTATTTTGACTAACTGG - Intronic
1121642439 14:95494804-95494826 TGGCCTTTTTTTTGAAGAGCAGG - Intergenic
1121786731 14:96667378-96667400 TACCCCTTATTTTACAGAAAAGG + Intergenic
1122866483 14:104607195-104607217 AGAGATTTATTTTAAAGAACTGG + Intergenic
1123798901 15:23801401-23801423 TGCCCATTATTTCTCAGAACTGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124660687 15:31548572-31548594 TGCTCTTCATTTTACAGAACAGG - Intronic
1125377102 15:39041757-39041779 TGCTTTTGATTTTTAAGAACTGG + Intergenic
1127704294 15:61531973-61531995 AGCACTATATTTTAAAGAAAAGG - Intergenic
1128918766 15:71591998-71592020 TGCCCCTCATTTTAAAGACGAGG + Intronic
1130400043 15:83543050-83543072 TGTCCTTTATCTTACAGGACAGG + Intronic
1134312083 16:13084142-13084164 AGCCCTTTATTTTAAAAACAAGG + Intronic
1134837797 16:17376517-17376539 TGTCTTTTCTGTTAAAGAACAGG + Intronic
1135796959 16:25454723-25454745 TCCCCTTTTTTTTAGAGAAATGG + Intergenic
1137448382 16:48547303-48547325 TGCTTTCTATTTTAAATAACTGG + Intronic
1137905219 16:52314830-52314852 TGCCCATTATTTGAGAGAGCTGG + Intergenic
1137922691 16:52506528-52506550 TGGCCCTTCTTTTAAAGAAGGGG + Intronic
1138484541 16:57329689-57329711 TGTCCTTTATTTTACAGATATGG + Intergenic
1139572894 16:67824405-67824427 TGCACTTGATTTTAAACAAAGGG - Intronic
1140016039 16:71186280-71186302 TATGTTTTATTTTAAAGAACAGG + Intronic
1140640036 16:76960862-76960884 TCCACTATATTTTACAGAACTGG + Intergenic
1143057740 17:4175026-4175048 TGTTCTTTCTTTTAAAAAACAGG - Intronic
1143784450 17:9246161-9246183 TGCCCCTTATTTTAAAAAGGGGG - Intergenic
1146251652 17:31351102-31351124 TGCCCTTTTTGTTATAGAAAGGG + Intronic
1148293604 17:46479223-46479245 AGCCCTTTATTTATAAAAACTGG - Intergenic
1148315790 17:46696925-46696947 AGCCCTTTATTTATAAAAACTGG - Intronic
1148928318 17:51107240-51107262 TGCAGTTTCTTTTAAAGAGCTGG - Intronic
1149004965 17:51795984-51796006 GGAGCTTTATTTTATAGAACGGG + Intronic
1150065520 17:62105669-62105691 TGCCCTTTATGATAAAGAAAGGG + Intergenic
1150595941 17:66604707-66604729 TGGACTTTCTTTTAAAGAAGTGG - Intronic
1151017221 17:70569399-70569421 TGTTCTTTACTTTAATGAACTGG - Intergenic
1152495993 17:80672034-80672056 TTATCTTTATTTTAAAGAAAGGG + Intronic
1153754503 18:8266267-8266289 TGCCCATGATTCTTAAGAACTGG - Intronic
1153794714 18:8610783-8610805 TGCCCTTTATTTTAAAGAACGGG - Intronic
1154338261 18:13482824-13482846 AGCCCTTTAGTTGAAAGAATAGG + Intronic
1154482272 18:14843642-14843664 TACCCTTAATTTTTAAAAACTGG + Intronic
1155975248 18:32121796-32121818 TTGACTTTATTTTAAAGAGCAGG + Intronic
1156787017 18:40927326-40927348 TACCTTTTTTTTTAAACAACTGG - Intergenic
1157266137 18:46224159-46224181 TGCCTTTTGTTTTAAACCACAGG + Intronic
1157938285 18:51897013-51897035 TCCCCTTTGTTTTAAAGATATGG - Intergenic
1158922071 18:62204263-62204285 TTAATTTTATTTTAAAGAACTGG + Intronic
1159469377 18:68831385-68831407 TTACCTCTATTTTAAAGAATTGG - Intronic
1160054901 18:75469854-75469876 AGCCCTTTATTTTATAGAAGGGG - Intergenic
1162551397 19:11360425-11360447 TTCCCTTTTTTTTAAAGAGGTGG - Intronic
1165416088 19:35694304-35694326 TCCCCTTTCTTTTAAAAGACGGG + Intergenic
925372819 2:3360093-3360115 TGGCCTTTCTTTATAAGAACTGG - Intronic
925475806 2:4213129-4213151 TGGCATTTTTTTTAAAGAAATGG - Intergenic
926202242 2:10810192-10810214 TGCCCATTATTTCACAGACCAGG + Intronic
927243725 2:20940409-20940431 TGGCCTTGACTTTAAAGAGCAGG + Intergenic
927606051 2:24488318-24488340 AGCCATATATTTTATAGAACTGG + Intergenic
927945674 2:27133898-27133920 TTACCTCTATTTTACAGAACAGG + Intronic
928570892 2:32607490-32607512 TGAGCCTTATTTTAATGAACCGG + Exonic
930625035 2:53687429-53687451 TGCCTGTTATCTTAAAAAACTGG - Intronic
930627236 2:53711378-53711400 TGCTCTCTATATTAAACAACTGG + Intronic
931777456 2:65552885-65552907 CTCTCTTTTTTTTAAAGAACAGG + Intergenic
932444446 2:71766758-71766780 AGAGATTTATTTTAAAGAACTGG - Intergenic
933134261 2:78711867-78711889 TGCAATTTATTTAAAAGAATTGG - Intergenic
933495036 2:83039886-83039908 TGGCTTTTAATTTAAAGGACAGG + Intergenic
933545256 2:83702566-83702588 TGCTGTTTATTTTTAAGAGCAGG - Intergenic
935498272 2:103807775-103807797 GGGCATATATTTTAAAGAACTGG + Intergenic
936616380 2:114051937-114051959 TGCAGTTTATTTTGAGGAACTGG - Intergenic
936654412 2:114468070-114468092 AGCCATTTATTTTAAATATCAGG + Intronic
937726236 2:125169608-125169630 TTACGTTTAGTTTAAAGAACTGG + Intergenic
938776706 2:134547432-134547454 TTCCCTTTATTTTTTTGAACTGG - Intronic
939498652 2:142952920-142952942 TGCCATTTTTTTTAAATAAATGG + Intronic
940384966 2:153059654-153059676 TGCCCTATTTTTAAAATAACAGG + Intergenic
940598613 2:155827683-155827705 TGCCCATTTTTTAAAAAAACTGG + Intergenic
945006602 2:205414566-205414588 TGTTCTTTACTTTAAAAAACTGG - Intronic
945502264 2:210590457-210590479 TGTCCTTGAGTTAAAAGAACTGG + Intronic
945893820 2:215459606-215459628 TACCCATTATTTTAAAGAGGAGG + Intergenic
946746650 2:222853189-222853211 TTCCCCTTATGTTAAAAAACTGG - Intergenic
947827368 2:233115527-233115549 TGTTCTTTGTTTTAAAGACCCGG + Intronic
1170507246 20:17040110-17040132 TCCCCTTTATTTTAAACTATTGG + Intergenic
1170762967 20:19267514-19267536 TGTCTTTTATTTTAAAAAAATGG - Intronic
1170794382 20:19533606-19533628 TGCCCTATATTTATAAGCACAGG - Intronic
1173150012 20:40558966-40558988 TCACCTTTACTTGAAAGAACGGG + Intergenic
1174802851 20:53579632-53579654 TGTCCTTTGTTCTAAAGAAAAGG - Intronic
1174897668 20:54468155-54468177 TGCCCTTTACCTTAAAGGAATGG + Intergenic
1175494228 20:59403067-59403089 TGCCCCTTTTTCTAAAGAGCAGG - Intergenic
1176056567 20:63152071-63152093 TGCACTTTATTTTGAACAAAAGG - Intergenic
1176150464 20:63588212-63588234 TTTCCTTTCTTTTTAAGAACAGG - Exonic
1176904864 21:14487995-14488017 AGCCCTTTTTTTTAATGAAAAGG + Intronic
1177412228 21:20744178-20744200 CAACCTTTATTTTTAAGAACAGG - Intergenic
1177528044 21:22322773-22322795 TCTTCTTTATTTTAAAAAACTGG + Intergenic
1177773299 21:25541051-25541073 TGGTTATTATTTTAAAGAACTGG - Intergenic
1178009441 21:28266365-28266387 TGCCCTATATTTTAAAATCCTGG + Intergenic
1178146362 21:29744874-29744896 TGACCTGTATTTTACAGAAGAGG + Intronic
1178417448 21:32415298-32415320 TTCCCTTTATTTAGAAAAACAGG - Intronic
1180744248 22:18076675-18076697 TGCACTTTATAGTAAAGTACTGG + Intergenic
1181878509 22:25958828-25958850 TGCCCCTTATCTTATAGAAATGG - Intronic
1182140451 22:27952073-27952095 TGCCCATTTTTTTAAAAGACAGG + Intergenic
1182962732 22:34490712-34490734 TTCCCTAAATATTAAAGAACTGG - Intergenic
949224560 3:1678592-1678614 TGCCCTTAATCTTTAGGAACAGG - Intergenic
949732324 3:7128127-7128149 GTCCCTTTACTTTAAAAAACTGG + Intronic
949922477 3:9013837-9013859 GCCCCTTTATGTTACAGAACTGG - Exonic
951355597 3:21663176-21663198 TACCTTTTATTTTAAAGATGAGG + Intronic
952153231 3:30615153-30615175 GGCACTTTATTTGAAAGGACTGG + Intronic
952511744 3:34065303-34065325 TTCCATTTGTTTTAAAGAAATGG + Intergenic
953062374 3:39438062-39438084 AGTCCTTTATTTTAAGGAATTGG + Intergenic
953205215 3:40821285-40821307 TCACCTTTATTTTATAGAATTGG - Intergenic
953527371 3:43703964-43703986 TGCATTTCTTTTTAAAGAACAGG - Intronic
955560090 3:60179561-60179583 TGCCATTTTTTTTTAAGAACAGG + Intronic
955933263 3:64078803-64078825 TCACCTTTTTTTTAAAAAACAGG + Intergenic
956749806 3:72336636-72336658 TCCTCTCTATTTTAAAGAAGAGG + Intergenic
957017741 3:75089150-75089172 TGCCCTTTAATTTTATGAAACGG + Intergenic
957301609 3:78398826-78398848 TGCCCTGTTTTTTGAAGTACAGG - Intergenic
957363217 3:79186021-79186043 AGCCCTTTATTTTAATGATGAGG + Intronic
957590781 3:82194857-82194879 TTCCCTTTATTTTACAGATGAGG + Intergenic
958576696 3:95958871-95958893 TGCTCTTTTATTTAAAAAACTGG + Intergenic
958988523 3:100812817-100812839 TGACATTTATTTTAAAACACTGG - Intronic
959706373 3:109342014-109342036 GGACATTTACTTTAAAGAACTGG + Intergenic
960163976 3:114380935-114380957 AGCCCTTTATTTTACAGATGAGG - Exonic
963247761 3:143078305-143078327 TGACCTTTTCTTTCAAGAACGGG + Intergenic
963493651 3:146032961-146032983 TGCTCTTTATTTTAATGCATAGG - Intergenic
963801841 3:149683954-149683976 TGCAATTTTTTTTAAAGAAATGG - Intronic
964147870 3:153487587-153487609 CTGCCTTTATTTTAAAGAAAGGG + Intronic
964240428 3:154586381-154586403 AGCCCTTTATTTGTAAAAACTGG - Intergenic
964703844 3:159597605-159597627 TTTCCTTTTTTTTAAAAAACAGG + Intronic
965163067 3:165160127-165160149 TGCCCTTGGTTTTATATAACTGG + Intergenic
967109266 3:186279161-186279183 TGCTCTTTATTCTCAAGAATGGG + Intronic
970876150 4:20872486-20872508 TGCTCTGTATTTTATAGACCTGG + Intronic
970986762 4:22168019-22168041 TGAGATTTATTTTAAAGAATTGG + Intergenic
971183905 4:24355395-24355417 TGCCTTTTATTGTCAAGAAGAGG + Intergenic
971339574 4:25755458-25755480 TGCCCTTTACTTTACAGATGAGG - Intronic
972729259 4:41777134-41777156 TGCCCTTTATTCTAAAGAATAGG + Intergenic
972954241 4:44369499-44369521 TCCCTTTTATTTTAAATAAGTGG - Intronic
973594375 4:52471223-52471245 TGATCTTTATTTTAAAGATGGGG - Intergenic
974932843 4:68379217-68379239 TTTCCTATATTTTAAAGAAAAGG + Intergenic
975342289 4:73256605-73256627 AGCCCTTTATTTTAAAAAGGAGG - Intronic
977862033 4:101973366-101973388 TGATCTTTATTTTACAGAATAGG + Intronic
978096263 4:104782449-104782471 AACCCTTTATTTTAAAGATGAGG - Intergenic
978335456 4:107663365-107663387 TGTACTTTTTTTTAAACAACTGG - Intronic
978398336 4:108306183-108306205 AGCCCCTTATTTTAAAGATGAGG + Intergenic
978764780 4:112392877-112392899 TTCCCTGTATCTGAAAGAACAGG + Intronic
978980937 4:114944761-114944783 TGCCCATTTTTTTAAAGATGTGG - Intronic
979070397 4:116196732-116196754 TGCCATCTATTTTACAGAAAAGG - Intergenic
980396147 4:132217957-132217979 TGACATATATTTTAGAGAACTGG + Intergenic
980505433 4:133713603-133713625 TGCACTTTATTATAAAACACTGG - Intergenic
980741220 4:136951935-136951957 TTCCCTTTTTTTTAAAAAAAGGG - Intergenic
981725110 4:147839279-147839301 TTCCCTTTAGTTTAATGAAATGG + Intronic
982384501 4:154786003-154786025 TGCTCTTAATTTTAAAGGAATGG + Intronic
982984450 4:162188331-162188353 TGGGCTTTATTATATAGAACTGG + Intergenic
983998408 4:174213396-174213418 TTCCCTTTATTATAAAGAGTAGG - Intergenic
984876343 4:184371322-184371344 TACTCTTCATTTTAAAGGACTGG - Intergenic
985383720 4:189422983-189423005 TGCCCTAGAATTTAAAGAAATGG - Intergenic
985798274 5:1981967-1981989 AAACATTTATTTTAAAGAACTGG - Intergenic
987376450 5:17239726-17239748 TGCCCTTCATTTGAAAACACAGG + Intronic
987521937 5:18997043-18997065 TGACGTTTCCTTTAAAGAACAGG - Intergenic
987756695 5:22105820-22105842 TGACCTTTATTTTTAAAAATAGG - Intronic
990068803 5:51752852-51752874 TCCCCTTTATTTTTAAGATTGGG - Intergenic
990220173 5:53579709-53579731 TCCCTTTTATTTTAAAGAGATGG - Intronic
991969604 5:72126279-72126301 ATCCCTTTATTTTACAGAAAAGG - Intronic
992425278 5:76650568-76650590 TGCTCTGTATTTTGGAGAACAGG - Intronic
992688625 5:79221863-79221885 TGCCCTTTGTTGAAAAGAATAGG - Intronic
993964139 5:94339820-94339842 TGGCCTGTTTCTTAAAGAACAGG - Intronic
994250338 5:97528746-97528768 TGCCCATTTTATTACAGAACCGG - Intergenic
994853067 5:105081523-105081545 TGCGATTTATTTTAGATAACAGG - Intergenic
995101259 5:108309419-108309441 TTACCTTTATTTTAAAAAAAAGG + Intronic
997249652 5:132378581-132378603 GGCCCTGTATTTTAAAGAAGAGG + Intronic
997522222 5:134530383-134530405 TTCCCCTTTTTTTAAAGAAGAGG + Intronic
998355022 5:141528007-141528029 TCTCATTTATTTTAGAGAACAGG + Intronic
998464329 5:142331322-142331344 TGTCCTTTATATAAAAGAATGGG + Intergenic
999017253 5:148120525-148120547 TGCTATTTATTTTCAAGATCTGG - Intronic
999425071 5:151480820-151480842 TGCCCTTTAGATTTAAGAATTGG - Intronic
999680356 5:154053308-154053330 TGCTCGTTATATTGAAGAACTGG + Exonic
1000444634 5:161304854-161304876 TGCCTCTTATTATAAAGTACAGG + Intronic
1002128536 5:177064944-177064966 TGCTCTTTAGTTGCAAGAACTGG - Exonic
1002444456 5:179280569-179280591 TGGCCTTTATTTTACAGGAGTGG - Intronic
1003147577 6:3521666-3521688 GGCCATTTATTTTAAAAAAGAGG + Intergenic
1003776919 6:9377396-9377418 TGAGGTTTACTTTAAAGAACTGG + Intergenic
1005071955 6:21870166-21870188 TGCTCTTTATTTTACAGATGAGG + Intergenic
1005109880 6:22268995-22269017 TCCCCTTTATTTTAACGAAGGGG - Intergenic
1005984997 6:30866181-30866203 TTCCCTTTATTGTGATGAACTGG - Intergenic
1007368841 6:41413164-41413186 TGCCCCTTTTTTTCAAGAAAAGG + Intergenic
1007802818 6:44412199-44412221 TGCTCTGTATTTTAATGAAAGGG - Intronic
1008866882 6:56222765-56222787 GTCCCTTTTTTTTAAAGAATAGG - Intronic
1010185750 6:73141486-73141508 TGCTCTTTGTATTATAGAACAGG + Intronic
1010702968 6:79074515-79074537 TGAGATTTATTTTAAAGAAAAGG - Intronic
1012471733 6:99580024-99580046 AGCAATTTATTTTAAAAAACAGG - Intergenic
1013005486 6:106069093-106069115 AGCCCTTTATTTTACAGGAGAGG - Intergenic
1013050905 6:106534065-106534087 TACACTTTTTTTTAAAGAATTGG + Intronic
1013081841 6:106820073-106820095 TGCCTTATATTTCAAACAACAGG + Intergenic
1014356357 6:120415806-120415828 TGCAATTTATTTTAAAAAAGAGG + Intergenic
1015544598 6:134348484-134348506 TGCCTTTTACTTTAAAGGAAAGG - Intergenic
1015710349 6:136132383-136132405 TGCCCTTTCCTGTAAAGAGCAGG + Intronic
1015739248 6:136435610-136435632 TGTCCTTTATTTTACAGAAGTGG + Intronic
1016130999 6:140470144-140470166 TTCCATTTATTTAAAAGAATAGG - Intergenic
1016131151 6:140473093-140473115 AGCCCTTTATTCAACAGAACGGG - Intergenic
1016639587 6:146333696-146333718 TGGCCTTTACTATAAAGACCTGG + Intronic
1017527345 6:155253149-155253171 TGCCTTTTATTTTATAGACAAGG + Intronic
1020473540 7:8567246-8567268 TTCATTTTATTTTAAATAACAGG + Intronic
1020885647 7:13816276-13816298 TGAGATTTATTTTAAGGAACTGG + Intergenic
1020972111 7:14957133-14957155 TGCCCTTTTTTTAAAAAAACTGG - Intronic
1021112023 7:16706486-16706508 AGCCATTTATTTTAAAAAACTGG - Exonic
1021327628 7:19293908-19293930 TGCCCTTCATTTTAAGTAAGTGG + Intergenic
1021463307 7:20913244-20913266 TTCCCTCCATTTTAAAGAAATGG + Intergenic
1021500125 7:21323652-21323674 TTCCCTTTAGTTTAAATAAAGGG + Intergenic
1021997303 7:26192772-26192794 GACCCTTTATTTAAAAGAATAGG - Intronic
1022057958 7:26759785-26759807 TTACCTTTATTTTAAAGATGGGG - Intronic
1022164688 7:27746385-27746407 TTCTTTTTTTTTTAAAGAACTGG + Intronic
1022811401 7:33872477-33872499 TGGCCTGTATTTCAAGGAACGGG - Intergenic
1023066618 7:36384196-36384218 TTTCCTTTGTTTAAAAGAACAGG + Intronic
1026281216 7:68923444-68923466 TGCCATTTATTTAAAAGTAATGG + Intergenic
1027644416 7:80779330-80779352 TGCCATTTATTTTAAAAAAAAGG + Intronic
1027795295 7:82685492-82685514 TGCCACTTATTTTAAAGCTCAGG + Intergenic
1027923235 7:84423356-84423378 TGCCCAGTATTTTTAAGAAATGG - Intronic
1027979154 7:85195213-85195235 TGCCCCTTATTTTAAACACTAGG + Intergenic
1028486262 7:91360852-91360874 TAACCTTTTTTTTAAAGAAGGGG - Intergenic
1029298891 7:99562928-99562950 TGCCGTTTATTTAAAAAGACAGG + Intronic
1029312338 7:99678960-99678982 TCCCCTTTATGTTACAGTACAGG - Intronic
1029353105 7:100029613-100029635 ACCCTTTTATTTTAAAGAAGGGG - Intronic
1030928142 7:115482926-115482948 TGCACTCTATTTTAATTAACTGG + Intergenic
1031163728 7:118201244-118201266 TTTCCTTTATATTAAAGAAGAGG + Intergenic
1031444672 7:121836610-121836632 TGCCCTTTGTTCAAAAGAAATGG - Intergenic
1031704982 7:124969141-124969163 TCCCCTTTATCTTACAGAAAAGG + Intergenic
1032876307 7:136041800-136041822 TACTCTCTATTTTAAAGAAATGG + Intergenic
1035428428 7:158798168-158798190 CGCCCTTTATTTTCAAAACCAGG - Intronic
1036758176 8:11485514-11485536 TGCCTTTAATTTAAAAGAAAAGG + Intergenic
1037169912 8:15878616-15878638 TACCCTTTGTTTGAAAGAATAGG - Intergenic
1038180431 8:25222335-25222357 TTCCATTTATTTTAAAGACAGGG - Intronic
1038183181 8:25248002-25248024 TGCGCTTACTTTTAAAGAACAGG - Intronic
1038779572 8:30558395-30558417 AACCCTTTTTTTAAAAGAACAGG + Intronic
1041192926 8:55371654-55371676 TCCACTTTATTTAAAAGTACTGG + Intronic
1041252134 8:55944868-55944890 TCCCCTTTATTTTGAACAAGAGG - Intronic
1041773678 8:61499906-61499928 TGCACTTAATTTTCAAAAACTGG - Exonic
1042530832 8:69813404-69813426 TGCTCTTTATTTTTAAGCAGGGG + Intronic
1043204490 8:77419867-77419889 TGCATTTTATTTTTAAAAACAGG - Intergenic
1043453811 8:80394107-80394129 TGCCTTTCATTTTACAGAAAGGG - Intergenic
1043775473 8:84262580-84262602 GGCCAGTTATTTTACAGAACAGG - Intronic
1044110760 8:88270095-88270117 TGTTCTTTGTCTTAAAGAACTGG - Intronic
1044781635 8:95749854-95749876 TGCCTGTTACTTTGAAGAACTGG - Intergenic
1044973294 8:97640596-97640618 TGCCCTTCATTTTATAGATGAGG - Intergenic
1045191769 8:99890776-99890798 TGCCCTTTATTTTTAATCAAAGG - Intronic
1046583438 8:116122180-116122202 AACACTTTATTCTAAAGAACAGG - Intergenic
1047029056 8:120856790-120856812 TATCATTTATTTTAAAGGACTGG - Intergenic
1047108745 8:121764910-121764932 TGCCCATTTTTCTGAAGAACAGG - Intergenic
1048201998 8:132382341-132382363 TACACGTTATTTTAAACAACCGG - Intronic
1048549567 8:135421858-135421880 TTCCTTTTCTTTTAAGGAACTGG + Intergenic
1050275259 9:3990894-3990916 TGCCCTCAATTTTGAAAAACAGG + Intronic
1050451944 9:5791206-5791228 TGAGATTTATTTTAAGGAACTGG + Intronic
1052282015 9:26743827-26743849 TGTCCTTTATTTTATAAAATAGG + Intergenic
1053331557 9:37213808-37213830 TGCACATTGTTTTAAAGAAATGG + Intronic
1053535865 9:38925042-38925064 TTCACTTTATTTTGAAGAAGAGG - Intergenic
1054208088 9:62149455-62149477 TTCACTTTATTTTGAAGAAGAGG - Intergenic
1054630268 9:67438910-67438932 TTCACTTTATTTTGAAGAAGAGG + Intergenic
1054964957 9:71013856-71013878 TGACCTATATTTTTAAGAACTGG + Intronic
1056548819 9:87635008-87635030 TACCCTTTATTTTATAGAAGGGG + Intronic
1057894440 9:98896263-98896285 AGCCAATTATTTTAAAGAACAGG + Intergenic
1058539078 9:105993250-105993272 TCCCATTGAATTTAAAGAACGGG - Intergenic
1059461295 9:114432134-114432156 TGCCCTTCATTTTAAGGCAGAGG + Intronic
1061285103 9:129618148-129618170 TGCCCATGAGTTTAAAGACCAGG - Intronic
1061424794 9:130492252-130492274 TGCCCTTTATTTGACAGGAGGGG - Intronic
1061724057 9:132571792-132571814 TGCCCTTTCTTCTCAAGAAATGG - Intronic
1061724783 9:132576131-132576153 TGCCCTTTCTTCTCAAGAAATGG - Intergenic
1062077341 9:134598005-134598027 TGCCCCTTATTTTACAGATAAGG - Intergenic
1187245353 X:17548950-17548972 TGTCCCTTTTTTTTAAGAACGGG + Intronic
1187249338 X:17582781-17582803 TTATCTTTATTTTAAAGAACAGG - Intronic
1187510744 X:19916028-19916050 TGCCCTCTCTTTTAAAGATATGG + Exonic
1189111751 X:38297952-38297974 TGCCATTTACTTTAAAAAACAGG + Intronic
1191998665 X:67124436-67124458 TGCCCTAGATATTAAAGAAAAGG + Intergenic
1194174768 X:90631852-90631874 TGCCCTTTCTATTATAGAAGAGG - Intergenic
1195927709 X:110042851-110042873 TGCCCATTTTTTGAAAAAACTGG + Intronic
1195975919 X:110526618-110526640 CCCCCTTTATTTTAAAAAAGAGG - Intergenic
1196089175 X:111720987-111721009 TGCCATATATTTTAAAAATCAGG - Intronic
1196358540 X:114824280-114824302 TGCCCTATGTTTTTAAGAGCTGG - Intronic
1196496599 X:116330715-116330737 TGCCTTTTAATTTGAAGAACTGG - Intergenic
1197806231 X:130401146-130401168 TTCCCTTTATTTTAGAGACAGGG + Intergenic
1198413923 X:136400671-136400693 TGCCATATTGTTTAAAGAACAGG + Intronic
1198543515 X:137667074-137667096 TACCTTTTGTTTTAAAGAGCCGG + Intergenic
1199019343 X:142858014-142858036 TGCTCTTTCTTCTAAAGCACCGG + Intergenic
1199200327 X:145080120-145080142 TGCTCTTTATTTTATAGTAATGG - Intergenic
1199453683 X:148002747-148002769 TTCTCACTATTTTAAAGAACTGG - Intronic
1199860343 X:151795609-151795631 TTCCCTATAATTTAAAGAAGAGG - Intergenic
1201411121 Y:13700459-13700481 TGCCCTTTAGTATATATAACGGG + Intergenic
1202258602 Y:22945696-22945718 TGCCCTTTAAGATAGAGAACAGG - Intergenic
1202411591 Y:24579454-24579476 TGCCCTTTAAGATAGAGAACAGG - Intergenic
1202459191 Y:25090618-25090640 TGCCCTTTAAGATAGAGAACAGG + Intergenic