ID: 1153795239

View in Genome Browser
Species Human (GRCh38)
Location 18:8615827-8615849
Sequence TTGTAAGTGCAGACAGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153795239 Original CRISPR TTGTAAGTGCAGACAGTGAA AGG (reversed) Intronic
901388196 1:8924976-8924998 TCGGCAGTACAGACAGTGAAAGG - Intergenic
901460291 1:9387228-9387250 GTGTAAGGGGAGAGAGTGAAGGG - Intergenic
902046823 1:13530851-13530873 TTGTAAGTGCAGACCGGGCGCGG + Intergenic
904502394 1:30922092-30922114 TTGTTATTGTAGACAGTTAAGGG + Intergenic
908785068 1:67727496-67727518 TTGTAAATGCTGACACTGACAGG - Intronic
913028050 1:114866039-114866061 TGGTATGTGCAAACAATGAATGG - Intronic
918129309 1:181611233-181611255 TTGCTAGTGGAGACAGTGAGAGG - Intronic
920720581 1:208382987-208383009 ATGTAAGTGGAGAGAGTGGAAGG + Intergenic
920859564 1:209694369-209694391 TGGGAAAGGCAGACAGTGAATGG + Intronic
921430058 1:215055262-215055284 TTCTAATTGCAAACAGTGATTGG - Intronic
922095495 1:222439800-222439822 TTGAAAAAGCAGAAAGTGAAAGG + Intergenic
922139232 1:222865621-222865643 TTTTAAGTGTAGACATTTAAAGG + Intergenic
923341632 1:233012430-233012452 TTGTAAGTGAAAAAACTGAAAGG + Intronic
924672528 1:246144048-246144070 TTATAAGTACAGTCAGGGAATGG - Intronic
1063113506 10:3056492-3056514 TTGGAAGTGCAGAAATAGAATGG + Intergenic
1066551634 10:36564960-36564982 CCGTAAGTGCAGATGGTGAAGGG - Intergenic
1067183706 10:44009448-44009470 TTCTAAGGGCAGAAGGTGAAGGG - Intergenic
1070291839 10:75122173-75122195 TTTTTAATGTAGACAGTGAAAGG + Intronic
1070484536 10:76916934-76916956 ATTTAAGTGCAGTCAGGGAATGG - Intronic
1070810097 10:79293296-79293318 TTGAAAGTGCAGGGAGGGAAGGG - Intronic
1073144666 10:101272650-101272672 TTGTAAGTGGGGACGGAGAAGGG + Intergenic
1078505367 11:11936962-11936984 TTGTAAATGCTGACAGTGATGGG - Intronic
1079640495 11:22799034-22799056 TTGTAAAAACACACAGTGAATGG + Intronic
1082993469 11:59229476-59229498 ATGTAAGTTCAGAAAGAGAAAGG - Intergenic
1083389982 11:62341523-62341545 TTGTAAGTCCAGAAAGAGACTGG - Intronic
1085809256 11:79665805-79665827 TTGTGAGTGATGACATTGAAGGG + Intergenic
1085844349 11:80048657-80048679 TTCTAAGTGGAGTAAGTGAAAGG + Intergenic
1089534506 11:119152453-119152475 TCCTTAGTGGAGACAGTGAAGGG - Intronic
1090476192 11:127023285-127023307 CTGTGAGTGCTGACAGCGAATGG - Intergenic
1090566847 11:128003623-128003645 TTGAAACTGCAGAAAGTCAAAGG - Intergenic
1091343124 11:134835365-134835387 TGGTGACTGCAGCCAGTGAAAGG - Intergenic
1092128850 12:6094323-6094345 TTATAGTTGCAGACACTGAAGGG - Intronic
1099028447 12:77495000-77495022 TTGAATGTGCAGACAGTGGGAGG + Intergenic
1102362002 12:112296199-112296221 ATGTAGGTGCAGACAGTGGTAGG + Intronic
1102362004 12:112296215-112296237 TGGTAGGTGCAGACAGTGGTAGG + Intronic
1103010849 12:117457119-117457141 CTGTCCGTGCAGACGGTGAAAGG + Exonic
1104054699 12:125220551-125220573 TTGGAAATGCCGACAGAGAAGGG - Intronic
1106458557 13:29948590-29948612 CTGTCAGTGCAGGAAGTGAAAGG + Intergenic
1107146496 13:37066299-37066321 GTGCAAGTGAAGACAGAGAAAGG + Intergenic
1109070549 13:57761065-57761087 ATGTAAGTATTGACAGTGAAAGG - Intergenic
1110498545 13:76198529-76198551 TTGTATGGTCAGACAGGGAAAGG - Intergenic
1110863708 13:80371693-80371715 GTGTAACTGCAGACATAGAAGGG + Intergenic
1113186513 13:107692818-107692840 TTGTTCAGGCAGACAGTGAATGG - Intronic
1120220331 14:81724596-81724618 ATGAAAATGAAGACAGTGAAAGG - Intergenic
1123671059 15:22657902-22657924 TAGAAAGTGCAGAAATTGAACGG + Intergenic
1124686481 15:31786999-31787021 TTCTTAGTGGAGACACTGAAAGG + Intronic
1127304154 15:57685650-57685672 TTGGAAGTGGAGACAGTAAGGGG - Intronic
1129768161 15:78183141-78183163 TTCTATGTGCAGAGAGTGAGTGG + Intronic
1130013173 15:80168042-80168064 TGGTAAGTGCAGCCTGAGAAAGG - Exonic
1130920760 15:88342623-88342645 TTCTAAATGCAGACCGTGATGGG - Intergenic
1132315315 15:100886106-100886128 TTGGAAGTGGATGCAGTGAAGGG + Intronic
1139330002 16:66180458-66180480 TTGTTGGTGCAGACAGTCAATGG + Intergenic
1140768035 16:78178100-78178122 CAGGAAGTGCTGACAGTGAAGGG + Intronic
1142499699 17:325409-325431 TTGTGAGTGCAAAATGTGAAGGG - Intronic
1142906174 17:3043827-3043849 TTCACAGTCCAGACAGTGAAGGG - Intergenic
1146523271 17:33543448-33543470 TTGAAAGTACAGACTGTAAATGG + Intronic
1150430974 17:65117002-65117024 TAGTAAGTGCAGAGAGTGTTTGG + Intergenic
1153795239 18:8615827-8615849 TTGTAAGTGCAGACAGTGAAAGG - Intronic
1154123485 18:11670179-11670201 TTGGAAGTGCAGGCAGTTAGAGG - Intergenic
1154486603 18:14876649-14876671 TTGTAAGTGAACAGAGAGAAAGG + Intergenic
925508531 2:4597759-4597781 TTGTAAGAGCAGAAAGCTAAAGG - Intergenic
925700867 2:6636429-6636451 CTGGAAGTGGAGACACTGAATGG - Intergenic
927220649 2:20705411-20705433 TGGTAAGTCCAAACAGTGAATGG - Intronic
927960755 2:27239397-27239419 TTTGAAGGGCAGAAAGTGAAGGG + Exonic
930767638 2:55100508-55100530 CTGCAACTGAAGACAGTGAAAGG + Intronic
931740357 2:65237231-65237253 TAGTAAGAGCAGACATTGCAAGG - Intronic
932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG + Intronic
934989984 2:98914225-98914247 TTGTAATTGCAGACATGGGAAGG + Intronic
935201583 2:100861360-100861382 TTCATAGTGCAGACAGAGAATGG + Intronic
940265820 2:151835705-151835727 TAGGAAGTGGAGGCAGTGAAAGG - Exonic
941689784 2:168488179-168488201 TGGTAAGTTCATAAAGTGAAGGG + Intronic
942562161 2:177231663-177231685 TTAGAAGTTCAGAGAGTGAATGG + Exonic
943253959 2:185569068-185569090 TTCTAATAGCAGACTGTGAAAGG + Intergenic
943468861 2:188266707-188266729 GTGTAGGTGCAGATAATGAAAGG - Intergenic
944124388 2:196276792-196276814 TTGTAAGTGCAGATATAGAAGGG - Intronic
944298110 2:198090993-198091015 TTGTAATTGCAGGCAGAGCATGG + Intronic
945648438 2:212530879-212530901 TTGAAAGAGAAGAAAGTGAATGG - Intronic
946542809 2:220704181-220704203 TTGTGAGTTCAGAAAGTGACAGG + Intergenic
946573713 2:221051563-221051585 GTGTAACTGCAGAGAGTGAAGGG - Intergenic
948433259 2:237934267-237934289 TAGGAGGGGCAGACAGTGAATGG - Intergenic
1170593243 20:17787025-17787047 TTTTAAGTGAAGAGAGTGAGGGG - Intergenic
1172205152 20:33158054-33158076 TTGGAAATGCAGACAGTCCAAGG - Intergenic
1172989037 20:39018281-39018303 TAGAAAGTCCAGACAGTGAGGGG + Intronic
1176794699 21:13362730-13362752 TTGTAAGTGAACAGAGAGAAAGG - Intergenic
1181480075 22:23193243-23193265 TTGACAGTGCAGACTTTGAAGGG + Intronic
1184633374 22:45804150-45804172 TTGTAGGAACAGACACTGAAGGG - Intronic
950530998 3:13552352-13552374 TTGGAAGTGGAGTGAGTGAAAGG + Intronic
953166193 3:40467033-40467055 TTGGAAGTGGAGATAATGAAAGG - Intergenic
953932467 3:47012543-47012565 TTGGGAGTCCAGACAGGGAAGGG - Intergenic
956387650 3:68737816-68737838 TAGGAAGTACATACAGTGAATGG - Intronic
957134048 3:76262386-76262408 TTGAAAAAGCAGACAGTGCATGG - Intronic
959948869 3:112155764-112155786 GTGAAAGAGCAGACGGTGAAGGG + Intronic
959974809 3:112446826-112446848 TTGTAAGTGCTGGCAGCTAATGG - Intergenic
962083523 3:132165979-132166001 TTTGAAGTGGAGACAGTGAGAGG - Intronic
962420748 3:135226545-135226567 TTGGAAGAGCAGAAACTGAAAGG - Intronic
962941003 3:140124841-140124863 AAGTGAGTGCAGATAGTGAATGG + Intronic
963112674 3:141700173-141700195 TTGGCAGTACAGATAGTGAAAGG + Intergenic
963868107 3:150384853-150384875 TTGGAAGTGCAGAGAGAGAAGGG + Intergenic
964003404 3:151804411-151804433 TTCTAAGTTCTGTCAGTGAATGG - Intergenic
964597853 3:158456802-158456824 TAGTAAGTGATGACATTGAAAGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966645357 3:182240537-182240559 TTGTAAGTACAGAAAATGGAGGG + Intergenic
970916099 4:21337062-21337084 TCGTAAAAGAAGACAGTGAAGGG + Intronic
971359087 4:25920180-25920202 TTGGAAGTCCAGCCAGTGGAGGG + Intronic
971461630 4:26904965-26904987 TTGAAAGTGTAGACAGTGGATGG + Intronic
971527303 4:27636781-27636803 TTTTAATTGCAGACAGAAAATGG - Intergenic
977546091 4:98380140-98380162 TTGTTAGTGACAACAGTGAATGG + Intronic
979149373 4:117290066-117290088 TTGAAGCTGCAGAAAGTGAAAGG - Intergenic
979791353 4:124785191-124785213 TTGTAAGGACAGAAAGAGAATGG - Intergenic
979913331 4:126398233-126398255 CTGTAACTTCAGAAAGTGAAAGG - Intergenic
981333243 4:143537447-143537469 TTGTAAGAGTTGTCAGTGAATGG + Intronic
982405779 4:155018729-155018751 TTTAAAGTGCATATAGTGAAGGG + Intergenic
982445466 4:155485863-155485885 TTGTAAGTGTAGACATAAAAGGG + Intergenic
983350146 4:166576328-166576350 TTTGAAGTGCAGACAGTGGGAGG + Intergenic
986344104 5:6818452-6818474 TGGGAAGTGTGGACAGTGAAGGG + Intergenic
988102289 5:26696000-26696022 GTGTAAGTGAAGAAATTGAAAGG + Intergenic
989439082 5:41448965-41448987 TTGCAGGTGCAGAAAGGGAAAGG - Intronic
990607025 5:57421410-57421432 TTGCAAGTGCAGCTACTGAAAGG - Intergenic
990754393 5:59052351-59052373 TTGTATGTGTGGACAGTAAATGG + Intronic
990910980 5:60851970-60851992 TTGTAAGGGAAAACAGTGATGGG + Intergenic
994643371 5:102438005-102438027 ATGTAAGTTTAGACATTGAAGGG - Intronic
995694990 5:114868501-114868523 TGGTAAGGGCAGCCAGAGAAAGG + Intergenic
996671998 5:126128833-126128855 TTCTAAGTGCAGAGGGTTAAAGG + Intergenic
997699389 5:135885882-135885904 TTGTAAGTGCAGAAATGGAGGGG + Intronic
998347506 5:141477418-141477440 TTGTAAGGGCTGAGAGGGAAGGG - Exonic
999442777 5:151615365-151615387 TTCTAAATGCAGACAGTGCCAGG + Intergenic
999633348 5:153594647-153594669 TTATAAGAGCAGATAGTCAAGGG - Intronic
1000118883 5:158178188-158178210 CTGTAACTGCAGAGAGAGAAGGG - Intergenic
1000369384 5:160520162-160520184 TAAAAAGTGCAGACAGGGAAGGG + Intergenic
1000723880 5:164743866-164743888 TGGTCATTGCAGACACTGAAGGG - Intergenic
1000999171 5:167989311-167989333 TTGTGAGTGCACAAAATGAAGGG + Intronic
1001227369 5:169956525-169956547 TTGTAAGTGAACAGAGAGAAAGG + Intronic
1002094299 5:176822095-176822117 TGGAAAATGCAGACAATGAAAGG + Intronic
1003920216 6:10825797-10825819 ATGTAAGTGGATACAGTCAAGGG - Intronic
1005295341 6:24420262-24420284 TTGTCGGTGCATTCAGTGAAGGG - Intronic
1005649394 6:27872710-27872732 TTGTAAATGGAGGCATTGAAGGG + Intergenic
1006807613 6:36798837-36798859 CTGTAAGTGAAGGGAGTGAAAGG - Intronic
1008297777 6:49799040-49799062 TTTCAAGTGCATACAGTGGAGGG - Intergenic
1009676702 6:66833415-66833437 TTGTTAGTGAAGACAGAGCATGG - Intergenic
1010959953 6:82134543-82134565 TAGGAAGTGAAGACTGTGAATGG - Intergenic
1014974166 6:127857902-127857924 TTATAAGTGGAGAGAGGGAAAGG + Intronic
1015006461 6:128287474-128287496 GTGAAAGAGCAGACAGTGAAAGG - Intronic
1015295354 6:131585136-131585158 CTGTAATTGCAGTAAGTGAAGGG - Intronic
1017459829 6:154638461-154638483 TTGGAAGTTCAGACAGAAAAGGG - Intergenic
1018540540 6:164874914-164874936 TAGGAAGTGCAGCCACTGAATGG + Intergenic
1022735272 7:33070372-33070394 CTGTCAGTGCACACAGTGCAAGG + Intergenic
1024345110 7:48305470-48305492 TTGTAAGACAAGACAATGAAAGG - Intronic
1024811600 7:53218955-53218977 TTGTAAGTACAGAGCGGGAAGGG - Intergenic
1026379489 7:69784645-69784667 TTGTAAGTGTAGAGAAAGAAAGG + Intronic
1027343735 7:77236584-77236606 TTGTAAGTTGAGAAAATGAATGG - Intronic
1027344902 7:77248893-77248915 TAGAAAGTACAGACAGTGAATGG - Intronic
1027811493 7:82905815-82905837 CGTTAAGTGCAGAAAGTGAAGGG + Intronic
1027859356 7:83556193-83556215 AGGTAAGTGCAGGCAGTGGAGGG - Intronic
1030070903 7:105696720-105696742 TTGCTAATGCAGACAGAGAAGGG + Intronic
1030934446 7:115567923-115567945 TTTAAAGTGAAGACAGTGATGGG - Intergenic
1030976021 7:116124228-116124250 CTTTGGGTGCAGACAGTGAAAGG + Intronic
1035721732 8:1797890-1797912 TGGTCAGAGGAGACAGTGAATGG - Intergenic
1035968563 8:4222169-4222191 TTGTGAGTGTAGACACAGAAGGG - Intronic
1037067857 8:14604982-14605004 ATGTAAAAGCAGACAGTAAATGG - Intronic
1039908653 8:41806767-41806789 TTGTAAGAGCAGATTGTGACAGG + Intronic
1040524110 8:48203697-48203719 TTGTAAGGGAAGACAGTCAAGGG - Intergenic
1042314077 8:67407247-67407269 TGTTAAGTGCAGACAGTAATTGG - Intergenic
1042469770 8:69172745-69172767 ATGTAATTGCTGACAGGGAAGGG + Intergenic
1043802270 8:84624517-84624539 TTCTAAGTGCAGTCAGTCAGAGG - Intronic
1044373130 8:91437453-91437475 TATTAAGTGGAGACTGTGAAAGG + Intergenic
1045695503 8:104805056-104805078 TTCTAAGTTCTGACAGAGAAAGG - Intronic
1050393265 9:5168808-5168830 TGTTAAGTGCAGCCAGAGAAAGG + Intronic
1053887532 9:42655461-42655483 TTGTAAGTGAACAGAGAGAAAGG + Intergenic
1059238471 9:112782870-112782892 TTGTAAGAGCAGACACTGGTGGG + Intronic
1059830625 9:118091331-118091353 TTGTAAGGGCAGTGAATGAATGG + Intergenic
1189601925 X:42636012-42636034 GTGTTTGTGCAGCCAGTGAAAGG + Intergenic
1189602850 X:42646359-42646381 TTCTAAATGCAGAGTGTGAAAGG + Intergenic
1189940887 X:46119660-46119682 GTGTAAGTGCAGAAAGGCAAAGG - Intergenic
1191632867 X:63341635-63341657 TTGTTAGTACAGATAATGAAGGG + Intergenic
1194038719 X:88914233-88914255 CTGTCATGGCAGACAGTGAAGGG + Intergenic
1195928184 X:110047219-110047241 TTCAAAGTGCAGATAGTTAAAGG + Intronic
1196185317 X:112739285-112739307 ATGTAAATGCAAACAGTAAAAGG - Intergenic
1196931292 X:120684409-120684431 TTGTATGTCCAGCCAATGAAGGG + Intergenic
1198428072 X:136539672-136539694 CAGTAAGTGTAGACAGAGAAAGG - Intronic
1199793285 X:151174743-151174765 CCGTAAGTGCAGACAGTGAAGGG - Intergenic
1200415828 Y:2908811-2908833 TTTTAAGTTCAGACAAGGAAAGG - Intronic
1200871218 Y:8100885-8100907 TGTTAAGGGCAGACAGAGAAAGG - Intergenic