ID: 1153797705

View in Genome Browser
Species Human (GRCh38)
Location 18:8640223-8640245
Sequence GCTGATGGAGAGCTAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153797701_1153797705 3 Left 1153797701 18:8640197-8640219 CCCTCTTGCTCTTCCTGTTAAAA No data
Right 1153797705 18:8640223-8640245 GCTGATGGAGAGCTAGAAGTTGG No data
1153797704_1153797705 -10 Left 1153797704 18:8640210-8640232 CCTGTTAAAATCTGCTGATGGAG No data
Right 1153797705 18:8640223-8640245 GCTGATGGAGAGCTAGAAGTTGG No data
1153797700_1153797705 8 Left 1153797700 18:8640192-8640214 CCAAACCCTCTTGCTCTTCCTGT No data
Right 1153797705 18:8640223-8640245 GCTGATGGAGAGCTAGAAGTTGG No data
1153797702_1153797705 2 Left 1153797702 18:8640198-8640220 CCTCTTGCTCTTCCTGTTAAAAT No data
Right 1153797705 18:8640223-8640245 GCTGATGGAGAGCTAGAAGTTGG No data
1153797698_1153797705 22 Left 1153797698 18:8640178-8640200 CCCAACTATATTTGCCAAACCCT No data
Right 1153797705 18:8640223-8640245 GCTGATGGAGAGCTAGAAGTTGG No data
1153797699_1153797705 21 Left 1153797699 18:8640179-8640201 CCAACTATATTTGCCAAACCCTC No data
Right 1153797705 18:8640223-8640245 GCTGATGGAGAGCTAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153797705 Original CRISPR GCTGATGGAGAGCTAGAAGT TGG Intergenic
No off target data available for this crispr