ID: 1153801421

View in Genome Browser
Species Human (GRCh38)
Location 18:8673994-8674016
Sequence GGACAGAAGTGAGCTCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153801421_1153801424 29 Left 1153801421 18:8673994-8674016 CCTAGGTGAGCTCACTTCTGTCC No data
Right 1153801424 18:8674046-8674068 TAACAAACAGAGAGAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153801421 Original CRISPR GGACAGAAGTGAGCTCACCT AGG (reversed) Intergenic
No off target data available for this crispr