ID: 1153801422

View in Genome Browser
Species Human (GRCh38)
Location 18:8674015-8674037
Sequence GACATAATGGTGTCAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153801422_1153801424 8 Left 1153801422 18:8674015-8674037 CCTACTTCTGACACCATTATGTC No data
Right 1153801424 18:8674046-8674068 TAACAAACAGAGAGAGAAGCTGG No data
1153801422_1153801425 22 Left 1153801422 18:8674015-8674037 CCTACTTCTGACACCATTATGTC No data
Right 1153801425 18:8674060-8674082 AGAAGCTGGCTAAAAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153801422 Original CRISPR GACATAATGGTGTCAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr