ID: 1153801423

View in Genome Browser
Species Human (GRCh38)
Location 18:8674028-8674050
Sequence TGTTATTTATGTTGACATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153801423_1153801424 -5 Left 1153801423 18:8674028-8674050 CCATTATGTCAACATAAATAACA No data
Right 1153801424 18:8674046-8674068 TAACAAACAGAGAGAGAAGCTGG No data
1153801423_1153801427 21 Left 1153801423 18:8674028-8674050 CCATTATGTCAACATAAATAACA No data
Right 1153801427 18:8674072-8674094 AAAGAAAGTGGTGTTTATTTGGG No data
1153801423_1153801428 27 Left 1153801423 18:8674028-8674050 CCATTATGTCAACATAAATAACA No data
Right 1153801428 18:8674078-8674100 AGTGGTGTTTATTTGGGAATAGG No data
1153801423_1153801425 9 Left 1153801423 18:8674028-8674050 CCATTATGTCAACATAAATAACA No data
Right 1153801425 18:8674060-8674082 AGAAGCTGGCTAAAAGAAAGTGG No data
1153801423_1153801426 20 Left 1153801423 18:8674028-8674050 CCATTATGTCAACATAAATAACA No data
Right 1153801426 18:8674071-8674093 AAAAGAAAGTGGTGTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153801423 Original CRISPR TGTTATTTATGTTGACATAA TGG (reversed) Intergenic
No off target data available for this crispr