ID: 1153801425

View in Genome Browser
Species Human (GRCh38)
Location 18:8674060-8674082
Sequence AGAAGCTGGCTAAAAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153801423_1153801425 9 Left 1153801423 18:8674028-8674050 CCATTATGTCAACATAAATAACA No data
Right 1153801425 18:8674060-8674082 AGAAGCTGGCTAAAAGAAAGTGG No data
1153801422_1153801425 22 Left 1153801422 18:8674015-8674037 CCTACTTCTGACACCATTATGTC No data
Right 1153801425 18:8674060-8674082 AGAAGCTGGCTAAAAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153801425 Original CRISPR AGAAGCTGGCTAAAAGAAAG TGG Intergenic
No off target data available for this crispr