ID: 1153801428

View in Genome Browser
Species Human (GRCh38)
Location 18:8674078-8674100
Sequence AGTGGTGTTTATTTGGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153801423_1153801428 27 Left 1153801423 18:8674028-8674050 CCATTATGTCAACATAAATAACA No data
Right 1153801428 18:8674078-8674100 AGTGGTGTTTATTTGGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153801428 Original CRISPR AGTGGTGTTTATTTGGGAAT AGG Intergenic
No off target data available for this crispr