ID: 1153804971

View in Genome Browser
Species Human (GRCh38)
Location 18:8703928-8703950
Sequence AGGATAATGCCCAACGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153804965_1153804971 -4 Left 1153804965 18:8703909-8703931 CCCCGTGGCTACCGCCTCTAGGA No data
Right 1153804971 18:8703928-8703950 AGGATAATGCCCAACGGCCTTGG No data
1153804967_1153804971 -6 Left 1153804967 18:8703911-8703933 CCGTGGCTACCGCCTCTAGGATA No data
Right 1153804971 18:8703928-8703950 AGGATAATGCCCAACGGCCTTGG No data
1153804966_1153804971 -5 Left 1153804966 18:8703910-8703932 CCCGTGGCTACCGCCTCTAGGAT No data
Right 1153804971 18:8703928-8703950 AGGATAATGCCCAACGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153804971 Original CRISPR AGGATAATGCCCAACGGCCT TGG Intergenic