ID: 1153805473

View in Genome Browser
Species Human (GRCh38)
Location 18:8705882-8705904
Sequence CCGCGAGGTTGGGCGAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153805473_1153805492 30 Left 1153805473 18:8705882-8705904 CCCGCGCTCGCCCAACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1153805492 18:8705935-8705957 CCGCGCCCGGCCGCCTCTCTCGG 0: 1
1: 0
2: 2
3: 22
4: 199
1153805473_1153805480 -2 Left 1153805473 18:8705882-8705904 CCCGCGCTCGCCCAACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1153805480 18:8705903-8705925 GGGCAAAGCGCCGCCCTCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 80
1153805473_1153805482 0 Left 1153805473 18:8705882-8705904 CCCGCGCTCGCCCAACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1153805482 18:8705905-8705927 GCAAAGCGCCGCCCTCGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 44
1153805473_1153805488 17 Left 1153805473 18:8705882-8705904 CCCGCGCTCGCCCAACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1153805488 18:8705922-8705944 CCGGGGTCCCTGGCCGCGCCCGG 0: 1
1: 0
2: 1
3: 21
4: 260
1153805473_1153805481 -1 Left 1153805473 18:8705882-8705904 CCCGCGCTCGCCCAACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1153805481 18:8705904-8705926 GGCAAAGCGCCGCCCTCGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 72
1153805473_1153805483 7 Left 1153805473 18:8705882-8705904 CCCGCGCTCGCCCAACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1153805483 18:8705912-8705934 GCCGCCCTCGCCGGGGTCCCTGG 0: 1
1: 0
2: 2
3: 30
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153805473 Original CRISPR CCGCGAGGTTGGGCGAGCGC GGG (reversed) Intronic